Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU079561

Sigma-Aldrich

MISSION® esiRNA

targeting human HMGCR

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCATTTGACAGCACTAGCAGATTTGCACGTCTACAGAAACTTCATACAAGTATAGCTGGACGCAACCTTTATATCCGTTTCCAGTCCAGGTCAGGGGATGCCATGGGGATGAACATGATTTCAAAGGGTACAGAGAAAGCACTTTCAAAACTTCACGAGTATTTCCCTGAAATGCAGATTCTAGCCGTTAGTGGTAACTATTGTACTGACAAGAAACCTGCTGCTATAAATTGGATAGAGGGAAGAGGAAAATCTGTTGTTTGTGAAGCTGTCATTCCAGCCAAGGTTGTCAGAGAAGTATTAAAGACTACCACAGAGGCTATGATTGAGGTCAACATTAACAAGAATTTAGTGGGCTCTGCCATGGCTGGGAGCATAGGAGGCTACAACGCCCATGCAGCAAACATTGTCACCGCCATCTACATTGCCTGTGGACAGGA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Robin A Lu et al.
Frontiers in pharmacology, 11, 469-469 (2020-05-22)
Despite maximal use of currently available therapies, a significant number of asthma patients continue to experience severe, and sometimes life-threatening bronchoconstriction. To fill this therapeutic gap, we examined a potential role for the 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR) inhibitor, pitavastatin. Using
Chang-Sook Hong et al.
Journal of extracellular vesicles, 9(1), 1800979-1800979 (2020-09-19)
Most patients with acute myeloid leukaemia (AML) experience disease recurrence after chemotherapy largely due to the development of drug resistance. Small extracellular vesicles (sEVs) are known to play a significant role in leukaemia drug resistance by delivery of anti-apoptotic proteins
Olöf Bjarnadottir et al.
Scientific reports, 10(1), 558-558 (2020-01-19)
Statins, commonly used to treat hypercholesterolemia, have also been proposed as anti-cancer agents. The identification of a predictive marker is essential. The 3-hydroxy-3-methylglutaryl-coenzyme-A reductase (HMGCR), which is inhibited by statins, might serve as such a marker. Thorough antibody validation was
Jiajun Huang et al.
EBioMedicine, 45, 251-260 (2019-06-16)
Statin-associated muscle symptoms (SAMS) are the major adverse effects of the class of widely used lipid-lowering agents, and the underlying mechanism remains elusive. In this study, we investigated the potential contribution and molecular mechanism of increased lactate production to SAMS

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.