Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU076241

Sigma-Aldrich

MISSION® esiRNA

targeting human ERG

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGGGGAAGAGATCCAAAGACTCTTGGGAGGGAGTTACTGAAGTCTTACTACAGAAATGAGGAGGATGCTAAAAATGTCACGAATATGGACATATCATCTGTGGACTGACCTTGTAAAAGACAGTGTATGTAGAAGCATGAAGTCTTAAGGACAAAGTGCCAAAGAAAGTGGTCTTAAGAAATGTATAAACTTTAGAGTAGAGTTTGGAATCCCACTAATGCAAACTGGGATGAAACTAAAGCAATAGAAACAACACAGTTTTGACCTAACATACCGTTTATAATGCCATTTTAAGGAAAACTACCTGTATTTAAAAATAGAAACATATCAAAAACAAGAGAAAAGACACGAGAGAGACTGTGGCCCATCAACAGACGTTGATATGCAACTGCATGGCATGTGCTGTTTTGGTTGAAATCAAATACATTCCGTTTGATGGACAGCT

N° accesso Ensembl | uomo

ENSG00000157554

N° accesso NCBI

NM_182918

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ERG(2078) , ERG(2078)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Rohit Bose et al.
Nature, 546(7660), 671-675 (2017-06-15)
Half of all prostate cancers are caused by the TMPRSS2-ERG gene-fusion, which enables androgens to drive expression of the normally silent E26 transformation-specific (ETS) transcription factor ERG in prostate cells. Recent genomic landscape studies of such cancers have reported recurrent
Chun-Wu Pan et al.
Theranostics, 11(4), 1780-1794 (2021-01-08)
Rationale: Enhancer RNA (eRNA) bi-directionally expresses from enhancer region and sense eRNA regulates adjacent mRNA in cis and in trans. However, it has remained unclear whether antisense eRNAs in different direction are functional or merely a reflection of enhancer activation.
Abdullah A Assiri et al.
Cancer genomics & proteomics, 16(6), 433-442 (2019-10-30)
hERG potassium channels enhance tumor invasiveness and breast cancer proliferation. MicroRNA (miRNA) dysregulation during cancer controls gene regulation. The objective of this study was to identify miRNAs that regulate hERG expression in breast cancer. Putative miRNAs targeting hERG were identified
Jung-Sun Kim et al.
Endocrinology, 155(9), 3262-3273 (2014-06-14)
A number of preclinical studies have shown that the activation of the vitamin D receptor (VDR) reduces prostate cancer (PCa) cell and tumor growth. The majority of human PCas express a transmembrane protease serine 2 (TMPRSS2):erythroblast transformation-specific (ETS) fusion gene
J Kim et al.
Oncogene, 33(44), 5183-5192 (2013-11-05)
Chromosomal translocations that juxtapose the androgen-sensitive transmembrane protease, serine 2 (TMPRSS2) gene promoter to the oncogenic ETS-family transcription factor ERG result in excessive ERG overexpression in approximately 50% of prostate cancer (PCa) patients. Although numerous studies have investigated ERG-downstream genes
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.