Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU075381

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM17

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGGTTGGTGAGCCTGACTCTAGGGTTCTAGCCCACATAAGAGATGATGATGTTATAATCAGAATCAACACAGATGGGGCCGAATATAACATAGAGCCACTTTGGAGATTTGTTAATGATACCAAAGACAAAAGAATGTTAGTTTATAAATCTGAAGATATCAAGAATGTTTCACGTTTGCAGTCTCCAAAAGTGTGTGGTTATTTAAAAGTGGATAATGAAGAGTTGCTCCCAAAAGGGTTAGTAGACAGAGAACCACCTGAAGAGCTTGTTCATCGAGTGAAAAGAAGAGCTGACCCAGATCCCATGAAGAACACGTGTAAATTATTGGTGGTAGCAGATCATCGCTTCTACAGATACATGGGCAGAGGGGAAGAGAGTACAACTACAAATTACTTAATAGAGCTAATTGACAGAGTTGATGACATCTATCGGAACACTTCATGGG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Takaaki Uchibori et al.
Cytokine, 90, 88-95 (2016-11-20)
Osteopontin (OPN) is a pro-fibrotic molecule upregulated by pro-inflammatory cytokines. Interleukin (IL)-6 functions downstream of IL-1β and has unique signal pathways: classic- or trans-signaling via membrane-bound IL-6R or soluble IL-6R (sIL-6R). We investigated the effect of IL-6 trans-signaling on the
Qi Zhang et al.
Biochemical and biophysical research communications, 503(4), 2333-2339 (2018-07-03)
We investigated the role of a disintegrin and metalloproteinase 17 (ADAM17) in chemo resistance, and to clarify the mechanism underlying reverse of L-OHP resistance by knockdown of ADAM17. CRC tissues with corresponding adjacent normal tissues were collected. The mRNA and
Junsuke Uwada et al.
Cellular signalling, 35, 188-196 (2017-04-17)
Intestinal epithelial cells form a tight barrier to act as selective physical barriers, repelling hostile substances. Tumor necrosis factor-α (TNF-α) is a well characterized pro-inflammatory cytokine which can compromise intestinal barrier function and the suppression of TNF-α function is important
Jacob J Orme et al.
Oncoimmunology, 9(1), 1744980-1744980 (2020-05-05)
ADAM10 and ADAM17 expression and soluble PD-L1 (sPD-L1) predict poor prognosis in many malignancies, including in patients treated with PD-(L)1 inhibitors. The mechanism of soluble PD-L1 production and its effects are unknown. Here we uncover a novel mechanism of ADAM10-
Min Xu et al.
International journal of oncology, 49(6), 2520-2528 (2016-10-26)
Although a disintegrin and metalloproteinase-17 (ADAM17) overexpression has been demonstrated in numerous human tumors including gastric cancer, its role in gastric cancer development remains to be clarified. In the present study, we identify that ADAM17 activates TGF-β/Smad signaling to promote

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.