Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU070071

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF12A

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTTCTGGCTTTTTGGTCTGGAGACGATGCCGCAGGAGAGAGAAGTTCACCACCCCCATAGAGGAGACCGGCGGAGAGGGCTGCCCAGCTGTGGCGCTGATCCAGTGACAATGTGCCCCCTGCCAGCCGGGGCTCGCCCACTCATCATTCATTCATCCATTCTAGAGCCAGTCTCTGCCTCCCAGACGCGGCGGGAGCCAAGCTCCTCCAACCACAAGGGGGGTGGGGGGCGGTGAATCACCTCTGAGGCCTGGGCCCAGGGTTCAGGGGAACCTTCCAAGGTGTCTGGTTGCCCTGCCTCTGGCTCCAGAACAGAAAGGGAGCCTCACGCTGGCTCACACAAAACAGCTGACACTGACTAAGGAACTGCAGCATTTGCACAGGGGAGGGGGGTGCCCTCCTTCCTAGAGGCCCTGGGGGCCAGGCTGACTTGGGGGGCAGACTTGACACTAGGCCC

N° accesso Ensembl | uomo

ENSG00000006327

N° accesso NCBI

NM_016639

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... TNFRSF12A(51330) , TNFRSF12A(51330)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xuefeng Qi et al.
Frontiers in cellular and infection microbiology, 7, 315-315 (2017-07-27)
TLR4 in intestinal epithelial cells has been shown both inflammatory and homeostatic roles following binding of its cognate ligand lipopolysaccharide (LPS). TWEAK-Fn14 axis plays an important role in pathologies caused by excessive or abnormal inflammatory responses. This study aimed to
Li Hao et al.
Journal of cellular and molecular medicine, 22(9), 4344-4353 (2018-07-05)
Atrial myocyte hypertrophy is one of the most important substrates in the development of atrial fibrillation (AF). The TWEAK/Fn14 axis is a positive regulator of cardiac hypertrophy in cardiomyopathy. This study therefore investigated the effects of Fn14 on atrial hypertrophy
Zhengwei Li et al.
American journal of translational research, 8(12), 5386-5398 (2017-01-13)
Angiotesin II (Ang II) plays an important role in cardiac remodeling. Fibroblast growth factor inducible-14 (Fn14) is the smallest member of the tumor necrosis factor superfamily of receptors. Currently, little is known about the functional role of Fn14 in the
Xuefeng Qi et al.
The Journal of general virology, 99(1), 36-43 (2017-12-09)
The pathogenesis of H9N2 subtype avian influenza virus (AIV) infection in hens is often related to oviduct tissue damage. Our previous study suggested that H9N2 AIV induces cellular apoptosis by activating reactive oxygen species (ROS) accumulation and mitochondria-mediated apoptotic signalling
Alison Roos et al.
Molecular cancer research : MCR, 16(7), 1185-1195 (2018-05-05)
Glioblastoma multiforme (GBM) is the most common brain malignancies in adults. Most GBM patients succumb to the disease less than 1 year after diagnosis due to the highly invasive nature of the tumor, which prevents complete surgical resection and gives
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.