Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU048861

Sigma-Aldrich

MISSION® esiRNA

targeting human PALB2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGCTGCCAAGCAGAAGAAAGAAGCAGCAGAAGAGGACATTTATTTCACAGGAGAGAGACTGTGTCTTTGGCACTGATTCACTCAGATTGTCTGGGAAAAGACTAAAGGAACAGGAAGAAATCAGTAGCAAAAATCCTGCTAGATCACCAGTAACTGAAATAAGAACTCACCTTTTAAGTCTTAAATCTGAACTTCCAGATTCTCCAGAACCAGTTACAGAAATTAATGAAGACAGTGTATTAATTCCACCAACTGCCCAACCAGAAAAAGGTGTTGATACATTCCTAAGAAGACCTAATTTCACCAGGGCGACTACAGTTCCTTTACAGACTCTATCAGATAGCGGTAGTAGTCAGCACCTTGAACACATTCCTCCTAAAGGTAGCAGTGAACTTACTACTCACGACCTAAAAAACATTAGATTTACTTCACCTGTAAGTTTGGAGGCACAAGGC

N° accesso Ensembl | uomo

ENSG00000083093

N° accesso NCBI

NM_024675

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PALB2(79728) , PALB2(79728)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ouyang Ge et al.
Oncology letters, 21(3), 224-224 (2021-02-23)
During DNA repair, BRCA1 and BRCA2 interact with the tumor suppressor partner and localizer of BRCA2 (PALB2). PALB2 mutations are associated with an increased risk of breast and ovarian carcinoma, and upregulated PALB2 expression is associated with poor clinical outcomes.
Antonis C Antoniou et al.
The New England journal of medicine, 371(6), 497-506 (2014-08-08)
Germline loss-of-function mutations in PALB2 are known to confer a predisposition to breast cancer. However, the lifetime risk of breast cancer that is conferred by such mutations remains unknown. We analyzed the risk of breast cancer among 362 members of
Joris Pauty et al.
Nucleic acids research, 45(5), 2644-2657 (2017-02-06)
One typical mechanism to promote genomic instability, a hallmark of cancer, is to inactivate tumor suppressors, such as PALB2. It has recently been reported that mutations in PALB2 increase the risk of breast cancer by 8-9-fold by age 40 and
Anar K Murphy et al.
The Journal of cell biology, 206(4), 493-507 (2014-08-13)
Phosphorylation of replication protein A (RPA) by Cdk2 and the checkpoint kinase ATR (ATM and Rad3 related) during replication fork stalling stabilizes the replisome, but how these modifications safeguard the fork is not understood. To address this question, we used

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.