Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU017501

Sigma-Aldrich

MISSION® esiRNA

targeting human CLDN1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Per informazioni sulla disponibilità, contatta il Servizio Clienti.


Scegli un formato

Cambia visualizzazione
20 μG
193,00 €
50 μG
342,00 €

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Per informazioni sulla disponibilità, contatta il Servizio Clienti.

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCAGATCCAGTGCAAAGTCTTTGACTCCTTGCTGAATCTGAGCAGCACATTGCAAGCAACCCGTGCCTTGATGGTGGTTGGCATCCTCCTGGGAGTGATAGCAATCTTTGTGGCCACCGTTGGCATGAAGTGTATGAAGTGCTTGGAAGACGATGAGGTGCAGAAGATGAGGATGGCTGTCATTGGGGGTGCGATATTTCTTCTTGCAGGTCTGGCTATTTTAGTTGCCACAGCATGGTATGGCAATAGAATCGTTCAAGAATTCTATGACCCTATGACCCCAGTCAATGCCAGGTACGAATTTGGTCAGGCTCTCTTCACTGGCTGGGCTGCTGCTTCTCTCTGCCTTCTGGGAGGTGCCCTACTTTGCTGTTCCTGTCCCCGAAAAACAACCTCTTACCCAACACCAAGGCCCTATCCAAAAC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Francescopaolo Di Cello et al.
PloS one, 8(7), e68630-e68630 (2013-07-12)
Downregulation of the tight junction protein claudin 1 is a frequent event in breast cancer and is associated with recurrence, metastasis, and reduced survival, suggesting a tumor suppressor role for this protein. Tumor suppressor genes are often epigenetically silenced in
Trevor R Leonardo et al.
International journal of molecular sciences, 21(8) (2020-04-29)
Bicellular tight junctions are multiprotein complexes that are required for maintenance of barrier function and fence function in epithelial tissues. Wound healing in the oral cavity leads to minimal scar formation compared to the skin, and the precise mechanisms for
Yi-Feng Zheng et al.
Journal of cellular biochemistry, 120(4), 6090-6105 (2018-12-07)
Colorectal carcinoma (CRC) is a major cause of cancer-related deaths worldwide, and investigations on novel targets are imperative. MiR-98 has been reported to act as a tumor suppressor in several cancers. To evaluate miR-98 as a novel anticancer molecule for
Jin Zhu et al.
Journal of translational medicine, 14(1), 166-166 (2016-06-10)
MicroRNAs have the potential as diagnostic biomarkers and therapeutic targets in autoimmune diseases. However, very limited studies have evaluated the expression of microRNA profile in thyroid gland related to Hashimoto's thyroiditis (HT). MicroRNA microarray expression profiling was performed and validated
Haruka Nasako et al.
International journal of molecular sciences, 21(16) (2020-08-23)
Claudin-1 (CLDN1), a tight junctional protein, is highly expressed in lung cancer cells and may contribute to chemoresistance. A drug which decreases CLDN1 expression could be a chemosensitizer for enhancing the efficacy of anticancer drugs, but there is no such

Domande

Recensioni

Nessuna valutazione

Filtri attivi

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.