Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU009931

Sigma-Aldrich

MISSION® esiRNA

targeting human BAMBI

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCAAAGGTGAAATTCGATGCTACTGTGATGCTGCCCACTGTGTAGCCACTGGTTATATGTGTAAATCTGAGCTCAGCGCCTGCTTCTCTAGACTTCTTGATCCTCAGAACTCAAATTCCCCACTCACCCATGGCTGCCTGGACTCTCTTGCAAGCACGACAGACATCTGCCAAGCCAAACAGGCCCGAAACCACTCTGGCACCACCATACCCACATTGGAATGCTGTCATGAAGACATGTGCAATTACAGAGGGCTGCACGATGTTCTCTCTCCTCCCAGGGGTGAGGCCTCAGGACAAGGAAACAGGTATCAGCATGATGGTAGCAGAAACCTTATCACCAAGGTGCAGGAGCTGACTTCTTCCAAAGAGTTGTGGTTCCGGGCAGCGGTCATTGCCGTGCCCATTGCTGGAGGGCTGATTTTAGTGTTGCTTATTATGTTGGCCCTGAGGATGCTTCGAAGTGAAAATAAGAGGCTGCAGGATCAGCGGCAACAGATGCTCTCCCGTTTGCACTACAGCTTTCACGG

N° accesso Ensembl | uomo

ENSG00000095739

N° accesso NCBI

NM_012342

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... BAMBI(25805) , BAMBI(25805)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
OAV
NZU
QCS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Longbiao Yang et al.
Molecular medicine reports, 20(4), 3901-3909 (2019-09-06)
To investigate the role of microRNA (miR)‑519d‑3p in postoperative epidural scar formation and its regulation of the bone morphogenetic protein and activin membrane‑bound inhibitor (BAMBI), miR‑519d‑3p and BAMBI expression levels in the lumbar disc of patients who had undergone laminectomy
Jingjing He et al.
Growth factors (Chur, Switzerland), 34(5-6), 210-216 (2017-02-18)
Fibroblast growth factor-1 (FGF-1) promotes differentiation of human preadipocytes into mature adipocytes via modulation of a BMP and Activin Membrane-Bound Inhibitor (BAMBI)/Peroxisome proliferator-activated receptor (PPARγ)-dependent network. Here, we combined transcriptomic and functional investigations to identify novel downstream effectors aligned with
Zhao Wang et al.
OncoTargets and therapy, 13, 131-142 (2020-02-06)
Non-small cell lung cancer (NSCLC) is a common malignancy over the world. Previous report indicated that the plasmacytoma variant translocation 1 (PVT1) has been documented to function as an oncogene in various types of human cancers. However, the biological mechanism
Long Bai et al.
Cellular signalling, 37, 52-61 (2017-06-05)
Bone morphogenetic protein and activin membrane-bound inhibitor (BAMBI) is a transforming growth factor β (TGF-β) type I receptor antagonist that negatively regulates TGF-β and bone morphogenetic protein (BMP) signaling. BAMBI has been shown to be regulated by TGF-β signaling; however
Christopher Grunseich et al.
Molecular cell, 69(3), 426-437 (2018-02-06)
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.