Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU003851

Sigma-Aldrich

MISSION® esiRNA

targeting human SAMHD1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACGCATGAACAAGGCTCAGTTATGATGTTTGAGCACCTTATTAATTCTAATGGAATTAAGCCTGTCATGGAACAATATGGTCTCATCCCTGAAGAAGATATTTGCTTTATAAAGGAACAAATTGTAGGACCACTTGAATCACCTGTCGAAGATTCATTGTGGCCATATAAAGGGCGTCCTGAAAACAAAAGCTTCCTTTATGAGATAGTATCTAATAAAAGAAATGGCATTGATGTGGACAAATGGGATTATTTTGCCAGGGACTGCCATCATCTTGGAATCCAAAATAATTTTGATTACAAGCGCTTTATTAAGTTTGCCCGTGTCTGTGAAGTAGACAATGAGTTGCGTATTTGTGCTAGAGATAAGGAAGTTGGAAATCTGTATGACATGTTCCACACTCGCAACTCTTTACACCGTAGAGCTTATCAACACAAAGTTGGCAACATTATTGATACAATGATTACAGATGCTTTCCTCAAAGCAGATGACTACATAGAGATTACAGGTGCTGGAGGAAAAAAGTATCGCATTTCTACAGCAATTGACGACATGGA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Weihui Fu et al.
Scientific reports, 6, 38162-38162 (2016-12-07)
SAMHD1 restricts human immunodeficiency virus type 1 (HIV-1) replication in myeloid cells and CD4+ T cells, while Vpx can mediate SAMHD1 degradation to promote HIV-1 replication. Although the restriction mechanisms of SAMHD1 have been well-described, SAMHD1 expression and Vpx-mediated SAMHD1
Vera Rocha-Perugini et al.
Nature microbiology, 2(11), 1513-1522 (2017-09-06)
In this study, we report that the tetraspanin CD81 enhances human immunodeficiency virus (HIV)-1 reverse transcription in HIV-1-infected cells. This is enabled by the direct interaction of CD81 with the deoxynucleoside triphosphate phosphohydrolase SAMHD1. This interaction prevents endosomal accumulation and
Simone De Meo et al.
PLoS pathogens, 16(9), e1008855-e1008855 (2020-09-29)
SAMHD1 is a host restriction factor that functions to restrict both retroviruses and DNA viruses, based on its nuclear deoxynucleotide triphosphate (dNTP) hydrolase activity that limits availability of intracellular dNTP pools. In the present study, we demonstrate that SAMHD1 expression
Thomas Oellerich et al.
Nature communications, 10(1), 3475-3475 (2019-08-04)
Hypomethylating agents decitabine and azacytidine are regarded as interchangeable in the treatment of acute myeloid leukemia (AML). However, their mechanisms of action remain incompletely understood, and predictive biomarkers for HMA efficacy are lacking. Here, we show that the bioactive metabolite
Petra Mlcochova et al.
Cell reports, 30(12), 3972-3980 (2020-03-27)
Macrophages exist predominantly in two distinct states, G0 and a G1-like state that is accompanied by phosphorylation of SAMHD1 at T592. Here, we demonstrate that Toll-like receptor 4 (TLR4) activation can potently induce G0 arrest and SAMHD1 antiretroviral activity by

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.