Skip to Content
Merck
All Photos(1)

Key Documents

EHU050511

Sigma-Aldrich

MISSION® esiRNA

targeting human SOD1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
HUF 75,800.00
50 μG
HUF 135,000.00

HUF 75,800.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
HUF 75,800.00
50 μG
HUF 135,000.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

HUF 75,800.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGGCATCATCAATTTCGAGCAGAAGGCAAGGGCTGGGACGGAGGCTTTGAAGGTGTGGGGAAGCATTAAAGGACTGACTGAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGTGCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAGGCATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTATTGAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTGGTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAAACATTCCCTTGGATGTAGTCTGAGGCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sujay Gaikwad et al.
Journal of biochemical and molecular toxicology, 32(9), e22176-e22176 (2018-07-12)
Anaplastic thyroid carcinoma (ATC) requires more innovative approaches as the current regimes for therapy are inadequate, also most anticancer drugs cause general suppression of physiological functions. However, therapy with limited nontarget tissue damage is desirable. In the present study, we
Yun-Li Wu et al.
Toxicology and applied pharmacology, 377, 114626-114626 (2019-06-16)
Microcystin-LR (MC-LR) is a type of cyclic heptapeptide toxin produced by cyanobacteria during bloom events. MC-LR-induced cell death is critically involved in its potent specific hepatotoxicity. Many studies have demonstrated that prototypical apoptosis as a form of programmed cell death

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service