Skip to Content
Merck
All Photos(1)

Key Documents

EHU038211

Sigma-Aldrich

MISSION® esiRNA

targeting human QSOX1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
HUF 75,800.00
50 μG
HUF 135,000.00

HUF 75,800.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
HUF 75,800.00
50 μG
HUF 135,000.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

HUF 75,800.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCAATGTGGTGAGAAAGTTTGGTGTCACCGACTTCCCCTCTTGCTACCTGCTGTTCCGGAATGGCTCTGTCTCCCGAGTCCCCGTGCTCATGGAATCCAGGTCCTTCTATACCGCTTACCTGCAGAGACTCTCTGGGCTCACCAGGGAGGCTGCCCAGACCACAGTTGCACCAACCACTGCTAACAAGATAGCTCCCACTGTTTGGAAATTGGCAGATCGCTCCAAGATCTACATGGCTGACCTGGAATCTGCACTGCACTACATCCTGCGGATAGAAGTGGGCAGGTTCCCGGTCCTGGAAGGGCAGCGCCTGGTGGCCCTGAAAAAGTTTGTGGCAGTGCTGGCCAAGTATTTCCCTGGCCGGCCCTTAGTCCAGAACTTCCTGCACTCCGTGAATGAATGGCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nicolas Pernodet et al.
Breast cancer research : BCR, 14(5), R136-R136 (2012-10-27)
The gene quiescin/sulfhydryl oxidase 1, QSOX1, encodes an enzyme directed to the secretory pathway and excreted into the extracellular space. QSOX1 participates in the folding and stability of proteins and thus could regulate the biological activity of its substrates in
Yibo Geng et al.
OncoTargets and therapy, 13, 5721-5729 (2020-07-02)
Quiescin sulfhydryl oxidase 1 (QSOX1) involves in the formation of disulfide bonds and participates in the protein folding process. In recent years, accumulating evidences have shown that QSOX1 is a biomarker for tumor development and prognosis. However, the biological function
Yonggang Ma et al.
Journal of neurotrauma, 36(15), 2337-2347 (2019-01-15)
Ependymal cells (EpCs) are a kind of multi-potent stem cells in the central canal of adult spinal cord, which proliferate following spinal cord injury (SCI). Although they can differentiate into functional neurons in vitro, EpC progeny differentiate mainly into astrocytes

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service