Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU107781

Sigma-Aldrich

MISSION® esiRNA

targeting human FFAR3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTACAACGTGTCCCATGTCGTGGGCTATATCTGCGGTGAAAGCCCGGCGTGGAGGATCTACGTGACGCTTCTCAGCACCCTGAACTCCTGTGTCGACCCCTTTGTCTACTACTTCTCCTCCTCCGGGTTCCAAGCCGACTTTCATGAGCTGCTGAGGAGGTTGTGTGGGCTCTGGGGCCAGTGGCAGCAGGAGAGCAGCATGGAGCTGAAGGAGCAGAAGGGAGGGGAGGAGCAGAGAGCGGACCGACCAGCTGAAAGAAAGACCAGTGAACACTCACAGGGCTGTGGAACTGGTGGCCAGGTGGCCTGTGCTGAAAGCTAGGTCCTCCGGGGGAGGAGGGTGTAGCTGGCATGTCATCCTCAGGGCGCTTCCTCGCTCACGCCAGGAGGGACTTGGAGTGGCGAGCTGGGGCCCGATGGGGCTTGGGGGCAGAGTAGACATCTAGCCTCCCTAAGGGTATGCGCGCTAAAGCCCAGCTCTCGATCTCACCTCC

Numéro d'accès Ensembl | humain

ENSG00000185897

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FFAR3(2865) , FFAR3(2865)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hideo Ohira et al.
Lipids in health and disease, 15(1), 213-213 (2016-12-13)
Interactions between adipocytes and macrophages are associated with metabolic disorders. Production of pro-inflammatory mediators and the release of free fatty acids (FFAs) increase when these cells are co-cultured; butyrate significantly diminishes these effects by suppressing both the macrophage inflammatory and
Hope Eveline Carter Moylan et al.
Molecular human reproduction, 26(6), 452-468 (2020-04-03)
Spontaneous preterm birth is a global health issue affecting up to 20% of pregnancies and leaves a legacy of neurodevelopmental complications. Inflammation has been implicated in a significant proportion of preterm births, where pro-inflammatory insults trigger production of additional pro-inflammatory
Estela Lorza-Gil et al.
Scientific reports, 10(1), 16497-16497 (2020-10-07)
The expression of short chain fatty acid receptors FFA2 and FFA3 in pancreatic islets raised interest in using them as drug targets for treating hyperglycemia in humans. This study aims to examine the efficacy of synthetic FFA2- and FFA3-ligands to
Mamiko Kobayashi et al.
Biochemical and biophysical research communications, 486(2), 499-505 (2017-03-23)
Short-chain fatty acids (SCFAs), such as acetate, propionate, and butyrate, are produced predominantly by gut microbiota fermentation of dietary fiber. SCFAs are newly identified as endogenous ligands of two orphan G protein-coupled receptors, GPR41 and GPR43, which have the potential
Rebecca Roy et al.
Journal of molecular endocrinology, 65(2), 21-34 (2020-06-25)
Gestational diabetes mellitus (GDM) affects up to 16% of pregnant women and is associated with significant long-term health detriments for the mother and her offspring. Two central features of GDM are low-grade inflammation and maternal peripheral insulin resistance, therefore therapeutics
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique