Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU131771

Sigma-Aldrich

MISSION® esiRNA

targeting human HAS2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTGGGTGTGTTCAGTGCATTAGTGGACCTCTGGGAATGTACAGAAACTCCTTGTTGCATGAGTTTGTGGAAGATTGGTACAATCAAGAATTTATGGGCAACCAATGTAGCTTTGGTGATGACAGGCATCTCACGAACCGGGTGCTGAGCCTGGGCTATGCAACAAAATACACAGCTCGATCTAAGTGCCTTACTGAAACACCTATAGAATATCTCAGATGGCTAAACCAGCAGACCCGTTGGAGCAAGTCCTACTTCCGAGAATGGCTGTACAATGCAATGTGGTTTCACAAACATCACTTGTGGATGACCTACGAAGCGATTATCACTGGATTCTTTCCTTTCTTTCTCATTGCCACAGTAATCCAGCTCTTCTACCGGGGTAAAATTTGGAACATTCTCCTCTTCTTGTTAACTGTCCAGCTAGTAGGTCTCATAAAATCATCTTTTGCCAGCTGCCTTA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hong Zhan et al.
Fertility and sterility, 114(4), 888-898 (2020-08-09)
To investigate the role(s) of hyaluronan synthase 2 (HAS2) and hyaluronan in disease progression of endometriosis and epidermal growth factor (EGF)-induced motility changes of endometriotic cells. A case-control experimental study and in vitro primary cell culture study. University hospital-affiliated research centers.
Xiaoyan Chen et al.
Cell communication and signaling : CCS, 18(1), 89-89 (2020-06-11)
Hyaluronan (HA) is an abundant component of the bone marrow (BM) extracellular matrix. Here, we investigated the abnormal deposition of HA in the BM microenvironment and its remodelling in mediating the malignancy of breast cancer cells (BCCs). BCCs were transplanted
Douglas Hanniford et al.
Cancer cell, 37(1), 55-70 (2020-01-15)
Metastasis is the primary cause of death of cancer patients. Dissecting mechanisms governing metastatic spread may uncover important tumor biology and/or yield promising therapeutic insights. Here, we investigated the role of circular RNAs (circRNA) in metastasis, using melanoma as a
Priscilla Soulié et al.
American journal of physiology. Cell physiology, 307(8), C745-C759 (2014-08-29)
Generation of branched tubes from an epithelial bud is a fundamental process in development. We hypothesized that induction of hyaluronan synthase (Has) and production of hyaluronan (HA) drives tubulogenesis in response to morphogenetic cytokines. Treatment of J3B1A mammary cells with

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique