Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU148801

Sigma-Aldrich

MISSION® esiRNA

targeting human YBX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAGATGAGACCCAAGGTCAGCAGCCACCTCAACGTCGGTACCGCCGCAACTTCAATTACCGACGCAGACGCCCAGAAAACCCTAAACCACAAGATGGCAAAGAGACAAAAGCAGCCGATCCACCAGCTGAGAATTCGTCCGCTCCCGAGGCTGAGCAGGGCGGGGCTGAGTAAATGCCGGCTTACCATCTCTACCATCATCCGGTTTAGTCATCCAACAAGAAGAAATATGAAATTCCAGCAATAAGAAATGAACAAAAGATTGGAGCTGAAGACCTAAAGTGCTTGCTTTTTGCCCGTTGACCAGATAAATAGAACTATCTGCATTATCTATGCAGCATGGGGTTTTTATTATTTTTACCTAAAGACGTCTCTTTTTGGTAATAACAAACGTGTTTTTTAAAAAAGCCTGGTTTTTCTCAATACGCCTTTAAAGGTTTTTAAATTGTTTCATATCTGGTCAAGTTGAGATTTTTAAGAACTTCATTTTTAATTTGTAATAAAAGTTTACAACTTGATTTTTTCAAAAAAGTCAACAAACTGCAAGCACCTG

Ensembl | nº de acceso humano

ENSG00000065978

Nº de acceso NCBI

NM_004559

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... YBX1(4904) , YBX1(4904)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
KDV
QCS
RXT
GUT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Cristina Pagano et al.
Oncotarget, 8(4), 6193-6205 (2016-12-23)
Correct spatial and temporal control of cell proliferation is of fundamental importance for tissue homeostasis. Its deregulation has been associated with several pathological conditions. In common with almost every aspect of plant and animal biology, cell proliferation is dominated by
Konstanze Lettau et al.
International journal of radiation oncology, biology, physics, 109(2), 567-580 (2020-09-16)
Y-box binding protein 1 (YB-1) overexpression is associated with chemotherapy- and radiation therapy resistance. Ionizing radiation (IR), receptor tyrosine kinase ligands, and mutation in KRAS gene stimulate activation of YB-1. YB-1 accelerates the repair of IR-induced DNA double-strand breaks (DSBs).
Aneri Shah et al.
Cancers, 12(8) (2020-08-09)
Cell fate decisions regulating survival and death are essential for maintaining tissue homeostasis; dysregulation thereof can lead to tumor development. In some cases, survival and death are triggered by the same receptor, e.g., tumor necrosis factor (TNF)-receptor 1 (TNFR1). We
Jia Pei Lim et al.
BMC cancer, 17(1), 201-201 (2017-03-18)
Y-box binding protein-1 is an evolutionary conserved transcription and translation regulating protein that is overexpressed in various human malignancies, including breast cancer. Despite reports of YB-1 and its association with distant spread of breast cancer, the intrinsic mechanism underlying this
Xueming Cao et al.
Free radical biology & medicine, 141, 10-20 (2019-06-04)
Y-box protein 1 (YB1) is a key regulator of inflammatory mediators. However, the roles of YB1 in oxidized low-density lipoprotein (ox-LDL)-induced macrophage inflammation and lipid uptake remain less understood. Thus, we explored the roles of YB1 in ox-LDL-induced macrophage inflammation
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico