Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU043571

Sigma-Aldrich

MISSION® esiRNA

targeting human YY1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTCACCATGTGGTCCTCAGATGAAAAAAAAGATATTGACCATGAGACAGTGGTTGAAGAACAGATCATTGGAGAGAACTCACCTCCTGATTATTCAGAATATATGACAGGAAAGAAACTTCCTCCTGGAGGAATACCTGGCATTGACCTCTCAGATCCCAAACAACTGGCAGAATTTGCTAGAATGAAGCCAAGAAAAATTAAAGAAGATGATGCTCCAAGAACAATAGCTTGCCCTCATAAAGGCTGCACAAAGATGTTCAGGGATAACTCGGCCATGAGAAAACATCTGCACACCCACGGTCCCAGAGTCCACGTCTGTGCAGAATGTGGCAAAGCTTTTGTTGAGAGTTCAAAACTAAAACGACACCAACTGGTTCATACTGGAGAGAAGCCCTTTCAGTGCA

Ensembl | nº de acceso humano

ENSG00000100811

Nº de acceso NCBI

NM_003403

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... YY1(7528) , YY1(7528)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DCV
VUU
MUU
SSU
ISU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

J-B Tian et al.
European review for medical and pharmacological sciences, 23(13), 5714-5729 (2019-07-13)
Increasing studies have confirmed long non-coding RNAs (lncRNAs) as novel regulators in tumorigenesis. LncRNA DDX11 antisense RNA 1 (DDX11-AS1) has been found to be abnormally expressed in several tumors. In this work, we aimed to evaluate its expressions and functions
Jiyeon Choi et al.
Nature communications, 11(1), 2718-2718 (2020-06-03)
Genome-wide association studies (GWAS) have identified ~20 melanoma susceptibility loci, most of which are not functionally characterized. Here we report an approach integrating massively-parallel reporter assays (MPRA) with cell-type-specific epigenome and expression quantitative trait loci (eQTL) to identify susceptibility genes/variants
Huan Liu et al.
Scientific reports, 10(1), 20493-20493 (2020-11-26)
Angiogenesis is a physiological process for the formation of new blood vessels from the pre-existing vessels and it has a vital role in the survival and growth of neoplasms. During tumor angiogenesis, the activation of the gene transcriptions in vascular
Jinpiao Lin et al.
Journal of autoimmunity, 77, 67-75 (2016-11-11)
Previous studies have revealed a critical role of YY1, a "Yin Yang" transcription factor, in cancer development and progression. However, whether YY1 has any role in rheumatoid arthritis (RA) remains unknown. This study aims to explore the potential role of
Xin-Chun Zhang et al.
Biochemical and biophysical research communications, 502(2), 269-275 (2018-05-29)
Neuroinflammation plays a critical role in the process of neurodegenerative disorders, during which microglia, the principal resident immune cells in the central nervous system, are activated and produce proinflammatory mediators. Yin-Yang 1 (YY1), a multi-functional transcription factor, is widely expressed
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico