Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU097711

Sigma-Aldrich

MISSION® esiRNA

targeting human PPARG

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGAATGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTGCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGTGATCAAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGTACTAGCAGAGAGTCCTGAGCCACTGCCAACATTTCCCTTCTTCCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Vahid Kheirollahi et al.
Nature communications, 10(1), 2987-2987 (2019-07-07)
Idiopathic pulmonary fibrosis (IPF) is a fatal disease in which the intricate alveolar network of the lung is progressively replaced by fibrotic scars. Myofibroblasts are the effector cells that excessively deposit extracellular matrix proteins thus compromising lung structure and function.
Pradip K Saha et al.
American journal of physiology. Endocrinology and metabolism, 319(4), E667-E677 (2020-08-18)
MicroRNA-30a (miR-30a) impacts adipocyte function, and its expression in white adipose tissue (WAT) correlates with insulin sensitivity in obesity. Bioinformatic analysis demonstrates that miR-30a expression contributes to 2% of all miRNA expression in human tissues. However, molecular mechanisms of miR-30a
Wenxin Hu et al.
Environmental science & technology, 51(7), 4061-4068 (2017-03-11)
2-Ethylhexyl diphenyl phosphate (EHDPP), an organophosphate flame retardant (OPFR), is frequently detected in human blood. In this study, the sensitive dual-luciferase reporter gene assay and molecular docking were used to investigate the activation of EHDPP to human peroxisome proliferator-activated receptor
Miao Xu et al.
Oncotarget, 8(56), 95914-95930 (2017-12-10)
The poor prognosis of esophageal squamous cell carcinoma (ESCC) emphasizes the urgent need to better understand the carcinogenesis and develop prevention strategies. Previous studies have highlighted the potential of using Vitamin E (tocopherols) for cancer chemoprevention, but the preventive activity

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico