Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU076241

Sigma-Aldrich

MISSION® esiRNA

targeting human ERG

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGGGAAGAGATCCAAAGACTCTTGGGAGGGAGTTACTGAAGTCTTACTACAGAAATGAGGAGGATGCTAAAAATGTCACGAATATGGACATATCATCTGTGGACTGACCTTGTAAAAGACAGTGTATGTAGAAGCATGAAGTCTTAAGGACAAAGTGCCAAAGAAAGTGGTCTTAAGAAATGTATAAACTTTAGAGTAGAGTTTGGAATCCCACTAATGCAAACTGGGATGAAACTAAAGCAATAGAAACAACACAGTTTTGACCTAACATACCGTTTATAATGCCATTTTAAGGAAAACTACCTGTATTTAAAAATAGAAACATATCAAAAACAAGAGAAAAGACACGAGAGAGACTGTGGCCCATCAACAGACGTTGATATGCAACTGCATGGCATGTGCTGTTTTGGTTGAAATCAAATACATTCCGTTTGATGGACAGCT

Ensembl | nº de acceso humano

ENSG00000157554

Nº de acceso NCBI

NM_182918

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ERG(2078) , ERG(2078)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
SZT
HQS
BWR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Abdullah A Assiri et al.
Cancer genomics & proteomics, 16(6), 433-442 (2019-10-30)
hERG potassium channels enhance tumor invasiveness and breast cancer proliferation. MicroRNA (miRNA) dysregulation during cancer controls gene regulation. The objective of this study was to identify miRNAs that regulate hERG expression in breast cancer. Putative miRNAs targeting hERG were identified
Rohit Bose et al.
Nature, 546(7660), 671-675 (2017-06-15)
Half of all prostate cancers are caused by the TMPRSS2-ERG gene-fusion, which enables androgens to drive expression of the normally silent E26 transformation-specific (ETS) transcription factor ERG in prostate cells. Recent genomic landscape studies of such cancers have reported recurrent
Chun-Wu Pan et al.
Theranostics, 11(4), 1780-1794 (2021-01-08)
Rationale: Enhancer RNA (eRNA) bi-directionally expresses from enhancer region and sense eRNA regulates adjacent mRNA in cis and in trans. However, it has remained unclear whether antisense eRNAs in different direction are functional or merely a reflection of enhancer activation.
J Kim et al.
Oncogene, 33(44), 5183-5192 (2013-11-05)
Chromosomal translocations that juxtapose the androgen-sensitive transmembrane protease, serine 2 (TMPRSS2) gene promoter to the oncogenic ETS-family transcription factor ERG result in excessive ERG overexpression in approximately 50% of prostate cancer (PCa) patients. Although numerous studies have investigated ERG-downstream genes
Ahmed A Mohamed et al.
Molecular cancer research : MCR, 15(10), 1308-1317 (2017-06-14)
The oncogenic activation of the ETS-related gene (
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico