Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU057281

Sigma-Aldrich

MISSION® esiRNA

targeting human E2F3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACCCTGGACCTCAAACTGTTAACCGAGGATTCAGAGAATCAAAGGTTAGCTTATGTTACATATCAAGATATTCGAAAAATTAGTGGCCTTAAAGACCAAACTGTTATAGTTGTGAAAGCCCCTCCAGAAACAAGACTTGAAGTGCCTGACTCAATAGAGAGCCTACAAATACATTTGGCAAGTACCCAAGGGCCCATTGAGGTTTACTTATGTCCAGAAGAGACTGAAACACACAGTCCAATGAAAACAAACAACCAAGACCACAATGGGAATATCCCTAAACCCGCTTCCAAAGACTTGGCTTCAACCAACTCAGGACATAGCGATTGCTCAGTTTCTATGGGAAACCTTTCTCCTCTGGCCTCCCCAGCCAACCTCTTACAGCAGACTGAGGACCAAATTCCTTCCAACCTAGAAGGACCGTTTGTGAACTTACTGCCTCCCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Junsheng Guo et al.
International journal of clinical and experimental pathology, 13(3), 587-596 (2020-04-10)
Bladder cancer is a common, serious disease worldwide. MicroRNAs (miRNAs) have been reported to participate in the development and progression in many cancers, including bladder cancer. However, the exact roles of miR-22 in bladder cancer process and its underlying mechanism
Satoko Nakashima et al.
European journal of dermatology : EJD, 27(5), 464-471 (2017-07-26)
Although angiosarcoma exhibits aggressive progression and is associated with unfavourable prognosis, its pathogenesis is poorly understood. In the present study, we investigated the possibility that microRNAs play a role in the pathogenesis of angiosarcoma. microRNA expression was evaluated by array
Zhicai Feng et al.
OncoTargets and therapy, 11, 5303-5313 (2018-09-15)
Melanoma is a malignant tumor that seriously affects patients. The pathogenesis of malignant melanoma is complex, and the cell cycle is closely related to tumor progression. Based on the catalog of cancer somatic mutations, we found that overexpression of the
Sivakumar Vadivel Gnanasundram et al.
Nature communications, 8(1), 2103-2103 (2017-12-14)
The c-myc oncogene stimulates ribosomal biogenesis and protein synthesis to promote cellular growth. However, the pathway by which cells sense and restore dysfunctional mRNA translation and how this is linked to cell proliferation and growth is not known. We here
Dianzhong Geng et al.
International journal of gynecological cancer : official journal of the International Gynecological Cancer Society, 25(4), 707-713 (2015-02-13)
Previous studies confirmed that high-risk human papillomavirus (HR-HPV) infection is a risk factor of cervical cancer, and the infection was associated with significantly reduced miR-34a expression during carcinogenesis. However, the downstream targets of miR-34a and their roles are still not

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico