Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
| Talla/SKU | Disponibilidad | Precio |
|---|---|---|
20 μg | Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde) | 212,00 € |
50 μg | Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde) | 378,00 € |
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
212,00 €
Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Segment
product line
MISSION®
form
lyophilized powder
shipped in
ambient
storage temp.
−20°C
General description
EHURLUC targets Renilla Luciferase. It can be used as a negative control in systems lacking Renilla Luciferase, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Other Notes
esiRNA cDNA target sequence: GATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATTTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTGATTGAATCATGGGATGAATGG
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
1 of 1
Este artículo | |||
|---|---|---|---|
| description targeting RLUC | description targeting FLUC | description targeting EGFP | description targeting human NDEL1 |
| product line MISSION® | product line MISSION® | product line MISSION® | product line MISSION® |
| form lyophilized powder | form lyophilized powder | form lyophilized powder | form lyophilized powder |
| storage temp. −20°C | storage temp. −20°C | storage temp. −20°C | storage temp. −20°C |
| description Powered by Eupheria Biotech | description Powered by Eupheria Biotech | description Powered by Eupheria Biotech | description Powered by Eupheria Biotech |
| Quality Level 100 | Quality Level 100 | Quality Level 100 | Quality Level 100 |
| shipped in ambient | shipped in ambient | shipped in ambient | shipped in ambient |
Clase de almacenamiento
10 - Combustible liquids
¿Qué está pasando?
WGK 1
Punto de inflamación (°F)
Not applicable
Punto de inflamación (°C)
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
