Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU109061

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACTAAGGCCAGACCCAAACTTTGATGCACTCATCAGCAAAATTTATCCAAGTCGTGATGAGTATGAAGCTCATCAAGAGAGAGTATTAGCCAGGATCAACAAGCACAATAATCAGCAAGCACTCAGTCACAGCATTGAGGAAGGACTGAAGATACAGGCCATGAACAGACTGCAGCGAGGCAAGAAACAACAGATTGAAAATGGTAGTGGAGCAGAAGATAATGGTGACAGTTCACACTGCAGTAATGCATCCACACATAGCAATCAGGAAGCAGGCCCTAGTAACAAACGGACCAAAACATCTGATGATTCTGGGCTAGAGCTTGATAATAACAATGCAGCAATGGCAATTGATCCAGTAATGGATGGTGCTAGTGAAATTGAATTAGTATTCAGGCCTCATCCCACACTTATGGAAAAAGATGACAGTGCACAGACGAGATACATAAAGACTTCTGGTAACGCCACTGTTG

Ensembl | nº de acceso humano

ENSG00000121481

Nº de acceso NCBI

NM_007212

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RNF2(6045) , RNF2(6045)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Feilong Wei et al.
Aging, 12(24), 26199-26220 (2020-12-22)
Ring finger protein 2 (RNF2) is an important component of polycomb repressive complex 1. RNF2 is upregulated in many kinds of tumors, and elevated RNF2 expression is associated with a poor prognosis in certain cancers. To assess the function of
Sen Zhu et al.
Nature communications, 9(1), 500-500 (2018-02-07)
BMI1, a polycomb group (PcG) protein, plays a critical role in epigenetic regulation of cell differentiation and proliferation, and cancer stem cell self-renewal. BMI1 is upregulated in multiple types of cancer, including prostate cancer. As a key component of polycomb
Brandon S Sheffield et al.
The American journal of surgical pathology, 39(7), 977-982 (2015-01-31)
A variety of immunohistochemical (IHC) stains have been proposed to mark either benign or malignant mesothelial proliferations. Loss of the p16 tumor suppressor (CDKN2A), through homozygous deletions of 9p21, is a good marker of mesotheliomas but lacks sensitivity. Recent reports

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico