Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU035531

Sigma-Aldrich

MISSION® esiRNA

targeting human UPF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGACGCCTACCAGTACCAGAACATATTCGGGCCCCTGGTCAAGCTGGAGGCCGACTACGACAAGAAGCTGAAGGAGTCCCAGACTCAAGATAACATCACTGTCAGGTGGGACCTGGGCCTTAACAAGAAGAGAATCGCCTACTTCACTTTGCCCAAGACTGACTCTGACATGCGGCTCATGCAGGGGGATGAGATATGCCTGCGGTACAAAGGGGACCTTGCGCCCCTGTGGAAAGGGATCGGCCACGTCATCAAGGTCCCTGATAATTATGGCGATGAGATCGCCATTGAGCTGCGGAGCAGCGTGGGTGCACCTGTGGAGGTGACTCACAACTTCCAGGTGGATTTTGTGTGGAAGTCGACCTCCTTTGACAGGATGCAGAGCGCATTGAAAACGTTTGCCGTGGATGAGACCTCGGTGTCTGGCTACATCTACCACAAGCTGTTGGGCCACGAGGTGGAGGACGTAAT

Ensembl | nº de acceso humano

ENSG00000005007

Nº de acceso NCBI

NM_002911

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... UPF1(5976) , UPF1(5976)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Aparna Kishor et al.
Nucleic acids research, 48(13), 7468-7482 (2020-06-17)
Alternative polyadenylation (APA) produces transcript 3' untranslated regions (3'UTRs) with distinct sequences, lengths, stabilities and functions. We show here that APA products include a class of cryptic nonsense-mediated mRNA decay (NMD) substrates with extended 3'UTRs that gene- or transcript-level analyses
Xiaojun Wang et al.
Environmental toxicology, 35(9), 998-1006 (2020-05-14)
The roles of long noncoding RNA (lncRNA) MACC1-AS1 have been revealed in various tumors. This work aims to explore the roles of lncRNA MACC1-AS1 in the stemness of nonsmall cell lung cancer (NSCLC) cells and the underlying mechanism. We showed
Seo-Young Lee et al.
Oncogene, 38(10), 1597-1610 (2018-10-24)
The point mutation that substitutes lysine with arginine at position 120 of human p53 has been characterized as a missense mutation. The K120R mutation renders the p53 protein disabled for acetylation and, as a result, defective for apoptotic function, which
Nagakatsu Harada et al.
Journal of cellular biochemistry, 118(11), 3810-3824 (2017-04-07)
Nonsense-mediated mRNA decay (NMD) degrades mRNAs carrying a premature termination codon (PTC) in eukaryotes. Cellular stresses, including endoplasmic reticulum (ER) stress, inhibit NMD, and up-regulate PTC-containing mRNA (PTC-mRNA) levels in several cell lines. However, whether similar effects exist under in
Tereza Grymová et al.
Molecular immunology, 107, 91-96 (2019-01-28)
Mutations in the C1 inhibitor (C1INH) encoding gene, SERPING1, are associated with hereditary angioedema (HAE) which manifests as recurrent submucosal and subcutaneous edema episodes. The major C1INH function is the complement system inhibition, preventing its spontaneous activation. The presented study
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico