Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU026121

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFSF10

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCAAGGGGGAATATTTGAGCTTAAGGAAAATGACAGAATTTTTGTTTCTGTAACAAATGAGCACTTGATAGACATGGACCATGAAGCCAGTTTTTTTGGGGCCTTTTTAGTTGGCTAACTGACCTGGAAAGAAAAAGCAATAACCTCAAAGTGACTATTCAGTTTTCAGGATGATACACTATGAAGATGTTTCAAAAAATCTGACCAAAACAAACAAACAGAAAACAGAAAACAAAAAAACCTCTATGCAATCTGAGTAGAGCAGCCACAACCAAAAAATTCTACAACACACACTGTTCTGAAAGTGACTCACTTATCCCAAGAGAATGAAATTGCTGAAAGATCTTTCAGGACTCTACCTCATATCAGTTTGCTAGCAGAAATCTAGAAGACTGTCAGCTTCCAAACATTAATGCAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lingyan Wang et al.
Oncology letters, 16(3), 3341-3350 (2018-08-22)
The survival benefits of sorafenib treatment for patients with hepatocellular carcinoma (HCC) are limited due to drug resistance and side effects. Therefore, combinations of sorafenib with other low toxicity drugs, including arsenic trioxide (As2O3) require investigation. The present study aimed
ZhengQiang Yuan et al.
Cytotherapy, 17(7), 885-896 (2015-04-19)
Mesenchymal stromal cell (MSC) delivery of pro-apoptotic tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) is an attractive strategy for anticancer therapy. MSCs expressing full-length human TRAIL (flT) or its soluble form (sT) have previously been shown to be effective for

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico