Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU014871

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGGCTTTCCCAAGCAAATAGCTGAAGACTTTCCAGGGATTGACTCAAAGATTGATGCTGTTTTTGAAGAATTTGGGTTCTTTTATTTCTTTACTGGATCTTCACAGTTGGAGTTTGACCCAAATGCAAAGAAAGTGACACACACTTTGAAGAGTAACAGCTGGCTTAATTGTTGAAAGAGATATGTAGAAGGCACAATATGGGCACTTTAAATGAAGCTAATAATTCTTCACCTAAGTCTCTGTGAATTGAAATGTTCGTTTTCTCCTGCCTGTGCTGTGACTCGAGTCACACTCAAGGGAACTTGAGCGTGAATCTGTATCTTGCCGGTCATTTTTATGTTATTACAGGGCATTCAAATGGGCTGCTGCTTAGCTTGCACCTTGTCACATAGAGTGATCTTTCCCAAGAGAAGGGGAAGCACTCGT

Ensembl | nº de acceso humano

ENSG00000149968

Nº de acceso NCBI

NM_002422

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MMP3(4314) , MMP3(4314)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yu Jin et al.
Journal of Cancer, 10(12), 2720-2734 (2019-07-02)
MicroRNA-519d (miR-519d) has been reported to play important roles in tumor development and progression in multiple cancers, either as tumor suppressor or tumor promotor. However, the expression level, biological function and molecular mechanisms of miR-519d in oral squamous cell carcinoma
Marina Boruk et al.
Scientific reports, 10(1), 16350-16350 (2020-10-03)
Chronic rhinosinusitis (CRS) is a common condition associated with inflammation and tissue remodeling of the nose and paranasal sinuses, frequently occurring with nasal polyps and allergies. Here we investigate inflammation and the protease profile in nasal tissues and plasma from
Nobuaki Ozeki et al.
Bioscience trends, 9(3), 160-168 (2015-07-15)
Although it is known that inorganic polyphosphate [Poly(P)] induces differentiation of osteoblasts, there are few reports concerning its effects on cell proliferation, especially in fibroblasts. Because we found that Poly(P) stimulates the proliferation of purified rat dental pulp fibroblast-like cells
Yu Deng et al.
Scientific reports, 10(1), 1386-1386 (2020-01-30)
High estrogen concentration leads to an inflammatory reaction in the mammary gland tissue in vivo; however, the detailed mechanism underlying its specific effects on the breast duct has not been fully clarified. We used 3D-cultured MCF-10A acini as a breast
Debarati Banik et al.
Oncotarget, 6(17), 15164-15179 (2015-05-27)
Interferon regulatory factor-8 (IRF8), originally identified as a leukemic tumor suppressor, can also exert anti-neoplastic activities in solid tumors. We previously showed that IRF8-loss enhanced tumor growth, which was accompanied by reduced tumor-cell susceptibility to apoptosis. However, the impact of
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico