Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU131291

Sigma-Aldrich

MISSION® esiRNA

targeting human MTA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGGAGGAGTGGTCTGCATCAGAGGCCAACCTTTTCGAGGAAGCCCTGGAAAAATATGGGAAGGATTTCACGGACATTCAGCAAGATTTTCTCCCGTGGAAGTCGCTGACCAGCATCATTGAGTACTACTACATGTGGAAGACCACCGACAGATACGTGCAGCAGAAACGCTTGAAAGCAGCTGAAGCTGAGAGCAAGTTAAAGCAAGTTTATATTCCCAACTATAACAAGCCAAATCCGAACCAAATCAGCGTCAACAACGTCAAGGCCGGTGTGGTGAACGGCACGGGGGCGCCGGGCCAGAGCCCTGGGGCTGGCCGGGCCTGCGAGAGCTGTTACACCACACAGTCTTACCAGTGGTATTCTTGGGGTCCCCCTAACATGCAGTGTCGTCTCTGCGCATCTTGTTGGACATATTGGAAGAAATATGGTGGCTTGAAAATGCCAACCCGGTTAGATGGAGAGAGGCCAGGA

Ensembl | nº de acceso humano

ENSG00000182979

Nº de acceso NCBI

NM_004689

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MTA1(9112) , MTA1(9112)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

S Deivendran et al.
Scientific reports, 7, 44225-44225 (2017-04-11)
Despite a recognized role of DNA methyltransferase 3a (DNMT3a) in human cancer, the nature of its upstream regulator(s) and relationship with the master chromatin remodeling factor MTA1, continues to be poorly understood. Here, we found an inverse relationship between the
Yongqin Pan et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1398-1406 (2016-10-25)
Dysregulation of microRNAs is involved in the initiation and progression of several human cancers, including breast cancer, as strong evidence of miRNAs acting as oncogenes or tumour suppressor genes has been found. This study was performed to investigate the biological
Wenhao Weng et al.
International journal of oncology, 44(3), 812-818 (2014-01-16)
Esophageal squamous cell carcinoma (ESCC) is one of the most common malignant tumors. Upregulation of metastasis-associated protein 1 (MTA1) has been reported to contribute to the development of esophageal squamous cell carcinoma. Therefore, the objective of our study was to identify
Hong Zhang et al.
Acta biochimica et biophysica Sinica, 47(7), 496-503 (2015-05-23)
Metastasis-associated gene 1 (MTA1) is associated with cell growth, metastasis, and survival in non-small-cell lung cancer (NSCLC). Several previous reports have demonstrated that microRNAs affect gene expression through interaction between their seed region and the 3'-untranslated region of the target
Ioannis Sanidas et al.
Molecular cell, 73(5), 985-1000 (2019-02-04)
Hyper-phosphorylation of RB controls its interaction with E2F and inhibits its tumor suppressor properties. However, during G1 active RB can be mono-phosphorylated on any one of 14 CDK phosphorylation sites. Here, we used quantitative proteomics to profile protein complexes formed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico