Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU008611

Sigma-Aldrich

MISSION® esiRNA

targeting human IFIH1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGCATGGAGGAGGAACTGTTGACAATTGAAGACAGAAACCGGATTGCTGCTGCAGAAAACAATGGAAATGAATCAGGTGTAAGAGAGCTACTAAAAAGGATTGTGCAGAAAGAAAACTGGTTCTCTGCATTTCTGAATGTTCTTCGTCAAACAGGAAACAATGAACTTGTCCAAGAGTTAACAGGCTCTGATTGCTCAGAAAGCAATGCAGAGATTGAGAATTTATCACAAGTTGATGGTCCTCAAGTGGAAGAGCAACTTCTTTCAACCACAGTTCAGCCAAATCTGGAGAAGGAGGTCTGGGGCATGGAGAATAACTCATCAGAATCATCTTTTGCAGATTCTTCTGTAGTTTCAGAATCAGACACAAGTTTGGCAGAAGGAAGTGTCAGCTGCTTAGATGAAAGTCTTGGACATAACAGCAACATGGGCA

Ensembl | nº de acceso humano

ENSG00000115267

Nº de acceso NCBI

NM_022168

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IFIH1(64135) , IFIH1(64135)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
HXU
ZRU
ERU
TLU
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tatsuro Saruga et al.
Molecular biology reports, 48(1), 425-433 (2021-01-03)
C-X-C motif chemokine 10 (CXCL10) is an inflammatory chemokine and a key molecule in the pathogenesis of rheumatoid arthritis (RA). Melanoma differentiation-associated gene 5 (MDA5) is an RNA helicase that plays a role in innate immune and inflammatory reactions. The
Ian T Lamborn et al.
The Journal of experimental medicine, 214(7), 1949-1972 (2017-06-14)
MDA5 is a cytosolic sensor of double-stranded RNA (ds)RNA including viral byproducts and intermediates. We studied a child with life-threatening, recurrent respiratory tract infections, caused by viruses including human rhinovirus (HRV), influenza virus, and respiratory syncytial virus (RSV). We identified
Chia-Lin Chen et al.
Nature communications, 8, 13882-13882 (2017-01-10)
B-cell infection by hepatitis C virus (HCV) has been a controversial topic. To examine whether HCV has a genetically determined lymphotropism through a co-receptor specific for the infection by lymphotropic HCV, we established an infectious clone and chimeric virus of
Seung Bum Park et al.
PloS one, 11(7), e0158419-e0158419 (2016-07-13)
Hepatitis C virus (HCV) actively evades host interferon (IFN) responses but the mechanisms of how it does so are not completely understood. In this study, we present evidence for an HCV factor that contributes to the suppression of retinoic-acid-inducible gene-I
Tongtian Zhuang et al.
Cell death & disease, 11(6), 453-453 (2020-06-14)
Vitiligo is a disfiguring disease featuring chemokines-mediated cutaneous infiltration of autoreactive CD8+ T cells that kill melanocytes. Copious studies have indicated that virus invasion participates in the pathogenesis of vitiligo. IFIH1, encoding MDA5 which is an intracellular virus sensor, has
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico