Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU079451

Sigma-Aldrich

MISSION® esiRNA

targeting human GSK3B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGATTTAAGAATCGAGAGCTCCAGATCATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGTTATTTCTTCTACTCCAGTGGTGAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACAGTATACAGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTGATTTATGTCAAGTTGTATATGTATCAGCTGTTCCGAAGTTTAGCCTATATCCATTCCTTTGGAATCTGCCATCGGGATATTAAACCGCAGAACCTCTTGTTGGATCCTGATACTGCTGTATTAAAACTCTGTGACTTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAACCCAATGTTTCG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Benjamin Stump et al.
PloS one, 14(4), e0213831-e0213831 (2019-04-10)
Lymphatic vessels play an important role in health and in disease. In this study, we evaluated the effects of GSK3-β inhibition on lung lymphatic endothelial cells in vitro. Pharmacological inhibition and silencing of GSK3-β resulted in increased lymphangiogenesis of lung
Baocheng Hu et al.
The Journal of biological chemistry, 292(8), 3531-3540 (2017-01-18)
miR-21, as an oncogene that overexpresses in most human tumors, is involved in radioresistance; however, the mechanism remains unclear. Here, we demonstrate that miR-21-mediated radioresistance occurs through promoting repair of DNA double strand breaks, which includes facilitating both non-homologous end-joining
Javier Duran et al.
PloS one, 11(12), e0168255-e0168255 (2016-12-16)
Testosterone induces cardiac hypertrophy through a mechanism that involves a concerted crosstalk between cytosolic and nuclear signaling pathways. Nuclear factor of activated T-cells (NFAT) is associated with the promotion of cardiac hypertrophy, glycogen synthase kinase-3β (GSK-3β) is considered to function
Linna Liu et al.
Oncology reports, 32(4), 1395-1400 (2014-08-12)
Rac1 has been shown to regulate the cell cycle in cancer cells. Yet, the related mechanism remains unclear. Thus, the present study aimed to investigate the mechanism involved in the regulation of G1/S phase transition by Rac1 in cancer cells.
M S Rashid et al.
Scientific reports, 8(1), 14259-14259 (2018-09-27)
The mitotic checkpoint ensures proper chromosome segregation; defects in this checkpoint can lead to aneuploidy, a hallmark of cancer. The mitotic checkpoint blocks progression through mitosis as long as chromosomes remain unattached to spindle microtubules. Unattached kinetochores induce the formation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico