Direkt zum Inhalt
Merck

EMU036041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ripk1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGATGCACGTGCTAAAGACCCAGATAGATGTCCCACTTTCATTGAAAGGAAGGATAATCGTGGAGGCCATAGAAGGCATGTGCTACTTACATGACAAAGGTGTGATACACAAGGACCTGAAGCCTGAGAATATCCTCGTTGATCGTGACTTTCACATTAAGATAGCCGATCTTGGTGTGGCTTCCTTTAAGACATGGAGCAAACTGACTAAGGAGAAAGACAACAAGCAGAAAGAAGTGAGCAGCACCACTAAGAAGAACAATGGTGGTACCCTTTACTACATGGCACCCGAACACCTGAATGACATCAATGCAAAGCCCACGGAGAAGTCGGACGTGTACAGCTTTGGCATTGTCCTTTGGGCAATATTTGCAAAAAAGGAGCCCTATGAGAATGTCATCTGTACTGAGCAGTTCGTGATCTGCATAAAATCTGGGAACAGGCCAAATGTAGAGGAAATCCTTGAGTACTGTCCAAGGGAGATCATCAGC

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yuichi Miki et al.
Lasers in medical science, 30(6), 1739-1745 (2015-06-26)
Photodynamic therapy (PDT) using photosensitizer induces several types of cell death, such as apoptosis, necrosis, and autophagy, depending on the PDT procedure, photosensitizer type, and cell type. We previously demonstrated that PDT using the photosensitizer talaporfin sodium (mono-L-aspartyl chlorine e6
Yoshiko Kaku et al.
Cellular signalling, 27(9), 1713-1719 (2015-05-26)
The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI)
W He et al.
Oncogene, 33(23), 3004-3013 (2013-07-09)
Killing cancer cells through the induction of apoptosis is one of the main mechanisms of chemotherapy. However, numerous cancer cells have primary or acquired apoptosis resistance, resulting in chemoresistance. In this study, using a novel chalcone derivative chalcone-24 (Chal-24), we
H Schoeneberger et al.
Oncogene, 34(31), 4032-4043 (2014-11-11)
Evasion of apoptosis in pediatric acute lymphoblastic leukemia (ALL) is linked to aberrant expression of inhibitor of apoptosis (IAP) proteins and dysregulated redox homeostasis, rendering leukemic cells vulnerable to redox-targeting therapies. Here we discover that inhibition of antioxidant defenses via
Pedram Kharaziha et al.
Oncotarget, 6(35), 37066-37082 (2015-09-30)
Autophagy is one of the main cytoprotective mechanisms that cancer cells deploy to withstand the cytotoxic stress and survive the lethal damage induced by anti-cancer drugs. However, under specific conditions, autophagy may, directly or indirectly, induce cell death. In our

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.