Direkt zum Inhalt
Merck

EHU092591

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF3 (1)

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTTTTCTCAGATCTGGTTTCTAAGAGTTTTGGGGGGCGGGGCTGTCACCACGTGCAGTATCTCAAGATATTCAGGTGGCCAGAAGAGCTTGTCAGCAAGAGGAGGACAGAATTCTCCCAGCGTTAACACAAAATCCATGGGCAGTATGATGGCAGGTCCTCTGTTGCAAACTCAGTTCCAAAGTCACAGGAAGAAAGCAGAAAGTTCAACTTCCAAAGGGTTAGGACTCTCCACTCAATGTCTTAGGTCAGGAGTTGTGTCTAGGCTGGAAGAGCCAAAGAATATTCCATTTTCCTTTCCTTGTGGTTGAAAACCACAGTCAGTGGAGAGATGTTTGGAAACCACAGTCAGTGGAGCCTGGGTGGTACCCAGGCTTTAGCATTATTGGATGTCAATAGCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Liugen Gu et al.
Pathology, research and practice, 214(6), 862-870 (2018-05-03)
Intestinal epithelial cell (IEC) apoptosis plays a vital role in the pathogenesis of Crohn's disease (CD), which is an inflammatory bowel disease (IBD). Activating transcription factor 3 (ATF3) modulates apoptosis under stress via regulating the p53 pathway. However, the expression
Siqi Ma et al.
International journal of molecular medicine, 35(6), 1561-1573 (2015-04-16)
Glioblastomas are highly malignant gliomas that are extremely invasive with high rates of recurrence and mortality. It has been reported that activating transcription factor 3 (ATF3) is expressed in elevated levels in multiple malignant tumors. The purpose of this study
Shunyan Weng et al.
BMC gastroenterology, 16, 25-25 (2016-02-27)
Hepatocellular carcinoma (HCC) is one of most common and aggressive human malignancies in the world, especially, in eastern Asia, and its mortality is very high at any phase. We want to investigate mechanism of niclosamide inducing cell apoptosis in HCC.
Chun-Chao Chen et al.
European journal of pharmacology, 859, 172542-172542 (2019-07-19)
Nicorandil is an adenosine triphosphate-sensitive potassium channel opener with additional antioxidant properties. Doxorubicin (DOX) is an anticancer drug that exerts oxidation-mediated adverse cardiovascular effects. This study examined the effects of nicorandil on DOX-induced cytotoxicity in human umbilical vein endothelial cells
Xiaolin Liu et al.
Frontiers in physiology, 11, 540591-540591 (2021-02-05)
Mechanical stretch promotes deregulation of vascular smooth muscle cell (VSMC) functions during hypertension-induced vascular remodeling. ACE2 has a wide range of cardiovascular and renal protective effects. Loss of ACE2 is associated with cardiovascular disease, but little is known about the

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.