Direkt zum Inhalt
Merck

EHU074041

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKAA1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGCTCAGAAGAGGAAGTTCTCAGCTGTCTTTACAACAGAAATCACCAGGATCCTTTGGCAGTTGCCTACCATCTCATAATAGATAACAGGAGAATAATGAATGAAGCCAAAGATTTCTATTTGGCGACAAGCCCACCTGATTCTTTTCTTGATGATCATCACCTGACTCGGCCCCATCCTGAAAGAGTACCATTCTTGGTTGCTGAAACACCAAGGGCACGCCATACCCTTGATGAATTAAATCCACAGAAATCCAAACACCAAGGTGTAAGGAAAGCAAAATGGCATTTAGGAATTAGAAGTCAAAGTCGACCAAATGATATTATGGCAGAAGTATGTAGAGCAATCAAACAATTGGATTATGAATGGAAGGTTGTAAACCCATATTATTTGCGTGTACGAAGGAAGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Takuma Hashimoto et al.
Biochemical and biophysical research communications, 505(1), 13-19 (2018-09-19)
Solid tumors often contain hypoxic regions because an abnormal and inefficient tumor vasculature is unable to supply sufficient oxygen. Tissue hypoxia is generally defined as a low oxygen concentration of less than 2%. It is well known that tumor cells
Cuiping Dai et al.
Oncotarget, 8(56), 95810-95823 (2017-12-10)
LB-100 is a novel PP2A inhibitor. Its activity in human colorectal cancer (CRC) cells was tested. The
You-Li Yao et al.
Toxicology letters, 281, 127-138 (2017-10-02)
The aim of this study was to investigate the effects of acanthoic acid (AA) on the regulation of inflammatory response, lipid accumulation, and fibrosis via AMPK- IRAK4 signaling against chronic alcohol consumption in mice. Ethanol-induced liver injury was induced in
Xue Han et al.
Oncogene, 38(38), 6537-6549 (2019-07-31)
Endometrial cancer (EC) is one of the most common gynecologic malignancies. However, the molecular mechanisms underlying the development and progression of EC remain unclear. Here, we demonstrated that the protein proviral insertion in murine lymphomas 2 (PIM2) was necessary for
Meriem Ladli et al.
Haematologica, 104(5), 907-918 (2018-10-13)
AMP-activated protein kinase (AMPK) is a heterotrimeric complex containing α, β, and γ subunits involved in maintaining integrity and survival of murine red blood cells. Indeed, Ampk α1-/- , Ampk β1-/- and Ampk γ1-/- mice develop hemolytic anemia and the

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.