Direkt zum Inhalt
Merck

EHU051271

Sigma-Aldrich

MISSION® esiRNA

targeting human PDGFRB

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGTGACACTGCACGAGAAGAAAGGGGACGTTGCACTGCCTGTCCCCTATGATCACCAACGTGGCTTTTCTGGTATCTTTGAGGACAGAAGCTACATCTGCAAAACCACCATTGGGGACAGGGAGGTGGATTCTGATGCCTACTATGTCTACAGACTCCAGGTGTCATCCATCAACGTCTCTGTGAACGCAGTGCAGACTGTGGTCCGCCAGGGTGAGAACATCACCCTCATGTGCATTGTGATCGGGAATGAGGTGGTCAACTTCGAGTGGACATACCCCCGCAAAGAAAGTGGGCGGCTGGTGGAGCCGGTGACTGACTTCCTCTTGGATATGCCTTACCACATCCGCTCCATCCTGCACATCCCCAGTGCCGAGTTAGAAGACTCGGGGACCTACACCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zachary K Goldsmith et al.
Investigative ophthalmology & visual science, 59(11), 4486-4495 (2018-09-08)
Vitreous seeding remains the primary reason for treatment failure in eyes with retinoblastoma (Rb). Systemic and intra-arterial chemotherapy, each with its own inherent set of complications, have improved salvage rates for eyes with advanced disease, but the location and biology
Bhanupriya Madarampalli et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(6), 1516-1524 (2019-03-17)
Cadherins are homophilic cell-to-cell adhesion molecules that help cells respond to environmental changes. Newly formed cadherin junctions are associated with increased cell phosphorylation, but the pathways driving this signaling response are largely unknown. Since cadherins have no intrinsic signaling activity
N Shioda et al.
Molecular psychiatry, 22(8), 1205-1222 (2016-12-07)
Aberrant dopamine D
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and
Yaoping Liu et al.
Genome research, 25(5), 679-689 (2015-04-11)
Candida albicans, the major invasive fungal pathogen of humans, can cause both debilitating mucosal infections and fatal invasive infections. Understanding the complex nature of the host-pathogen interaction in each of these contexts is essential to developing desperately needed therapies to

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.