Přejít k obsahu
Merck
Všechny fotografie(1)

Hlavní dokumenty

EMU050011

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Snai1

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAACCCACTCGGATGTGAAGAGATACCAGTGCCAGGCCTGTGCCCGAACCTTCTCCCGCATGTCCTTGCTCCACAAGCACCAAGAGTCTGGCTGCTCCGGAGGCCCTCGCTGACCCTGCTACCTCCCCATCCTCGCTGGCATCTTCCCGGAGCTCACCCTCCTCCTCACTGCCAGGACTCCTTCCAGCCTTGGTCCGGGGACCTGTGGCGTCCATGTCTGGACCTGGTTCCTGCTTGGCTCTCTTGGTGGCCTTTGCCGCAGGTGGCTGATGGAGTGCCTTTGTACCCGCCCAGAGCCTCCTACCCCTCAGTATTCATGAGGTGTAGCCTCTGGACACAGCTGCTTCGAGCCATAGAACTAAAGCCAACCCACTGGCTGGGAAGCTTGAACCCCGCTCAGGGGACCCCACTTCCCTACCTCCCTCAAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Vyberte jednu z posledních verzí:

Osvědčení o analýze (COA)

Lot/Batch Number

Nevidíte správnou verzi?

Potřebujete-li konkrétní verzi, můžete vyhledat daný certifikát podle čísla dávky nebo čísla šarže.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Qingsheng Dong et al.
PloS one, 9(6), e98651-e98651 (2014-06-25)
Glioblastoma is an extraordinarily aggressive disease that requires more effective therapeutic options. Snail family zinc finger 1, dysregulated in many neoplasms, has been reported to be involved in gliomas. However, the biological mechanisms underlying SNAI1 function in gliomas need further
Wai-Kin So et al.
FEBS letters, 588(21), 3998-4007 (2014-09-28)
Aberrant epidermal growth factor receptor (EGFR) activation is associated with ovarian cancer progression. In this study, we report that the EGFR ligand amphiregulin (AREG) stimulates cell invasion and down-regulates E-cadherin expression in two human ovarian cancer cell lines, SKOV3 and
Whajung Cho et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4287-4297 (2015-04-01)
PGs are emerging as important immune modulators. Since our report on the expression of PG synthases in human follicular dendritic cells, we investigated the potential immunoregulatory function of PGs and their production mechanisms. In this study, we explored the intracellular
Prathap Kumar S Mahalingaiah et al.
Journal of cellular physiology, 230(8), 1916-1928 (2014-12-30)
Oxidative injury to cellular macromolecules has been suggested as a common pathway shared by multiple etiological factors for kidney cancer. Whether the chronic oxidative stress alone is sufficient to induce malignant transformation in human kidney cells is not clear. Therefore

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.