Přejít k obsahu
Merck
Všechny fotografie(1)

Key Documents

EMU010641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Map2k1

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen
Všechny fotografie(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAGCATCTGAGCCTTTAGGAAGCAGCAAAGAGGAATTCTCTGCCCAGTGGCATGCCATGTTGCTTTCAGGCCTCTCCCATGCTTGTCTATGTTCAGACGTGCATCTCATCTGTGACAAAGGATGAAGAACACAGCATGTGCCAAATTGTACTTGTGTCATTTTTAATATCATTGTCTTTATCACTATGGTTACTCCCCTAAGTGGATTGGCTTTGTGCTTGGGGCTATTTGTCTGTTCATCAAACACATGCCAGGCTGAACTACAGTGAAACCCTAGTGACCTGGGTGGTCGTTCTTACTGATGTTTGCACTGCTGTTCATCGTGACTCACTAGCTGGCTGCCTGTATTGTCAGGATTCTCGGACCTTGGTACTTCACTCTTGCTGGTGACCTCTCAGTCTGAGAGGGAGCCTTGTG

Ensembl | mouse accession no.

ENSMUSG00000004936

NCBI accession no.

NM_008927

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... MAP2K1(26395) , Map2k1(26395)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

Map2k1 (dual specificity mitogen-activated protein kinase kinase 1) is a serine threonine kinase and is required for ERK (extracellular-signal-regulated kinase) activation. Activation of ERK is associated with production of IL-10 (interleukin 10) and IL-12. Absence of the Map2k1 gene results in embryonic lethality. Map2k1 is responsible for the stimulation of epidermal proliferation, regulating cell migration in fibroblasts. Deficiency of Map2k1 protein causes lupus-like syndrome.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Jui-Tai Chen et al.
Toxicology, 339, 40-50 (2015-12-15)
Glutamate can activate NMDA receptor (NMDAR) and subsequently induces excitotoxic neuron loss. However, roles of NMDARs in the blood-brain barrier (BBB) are little known. This study used a mouse cerebrovascular endothelial cell (MCEC) model to evaluate the effects of NMDAR
Mohamad Bouhamdan et al.
Cellular signalling, 27(10), 2068-2076 (2015-07-26)
The mitogen activated protein kinases ERK1/2 play an important role in response to toll like receptor (TLR) activation and cytokine production, including IL-10 and IL-12. Here, we examined the role of MEK1 in ERK1/2 activation in response to TLR4 agonist
Elisa Zienert et al.
Cancer letters, 364(1), 17-24 (2015-04-29)
Numerous factors determine the current poor prognosis of pancreatic ductal adenocarcinoma (PDAC). One of the greatest challenges to overcome is treatment resistance. Among a large repertoire of intrinsic resistance mechanisms, integrin-mediated cell adhesion to extracellular matrix (ECM) has been identified
Li Ren Kong et al.
Molecular cancer therapeutics, 14(7), 1750-1760 (2015-05-06)
Genomic analyses of squamous cell carcinoma (SCC) have yet to yield significant strategies against pathway activation to improve treatment. Platinum-based chemotherapy remains the mainstay of treatment for SCC of different histotypes either as a single-agent or alongside other chemotherapeutic drugs

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.