Přejít k obsahu
Merck
Všechny fotografie(1)

Key Documents

EHU147561

Sigma-Aldrich

MISSION® esiRNA

targeting human PKM

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen
Všechny fotografie(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTGATTCACCACCCATCACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACG

Ensembl | human accession no.

ENSG00000067225

NCBI accession no.

NM_002654

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PKM(5315) , PKM2(5315)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Pu-Hyeon Cha et al.
British journal of cancer, 124(3), 634-644 (2020-10-20)
Most cancer cells employ the Warburg effect to support anabolic growth and tumorigenesis. Here, we discovered a key link between Warburg effect and aberrantly activated Wnt/β-catenin signalling, especially by pathologically significant APC loss, in CRC. Proteomic analyses were performed to
Hai Hu et al.
Journal of Cancer, 11(8), 2022-2031 (2020-03-05)
Macrophages play a critical role in the initiation and progression in various human solid tumors; however, their role and transformation in pancreatic ductal adenocarcinoma (PDAC) were still illusive. Here, immunohistochemistry was used to determine CD206 (specific marker of M2 macrophage)
Guo-Bin Ding et al.
Polymers, 12(2) (2020-02-23)
Polyethylenimine (PEI) is a gold standard polymer with excellent transfection efficacy, yet its severe toxicity and nondegradability hinders its therapeutic application as a gene delivery vector. To tackle this problem, herein we incorporated the biodegradable polylactide (PLA) into the branched
Ran Ao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 42(5), 1769-1778 (2017-07-27)
This paper aims to explore the effects of pyruvate kinase (PK) M2 gene silencing on the proliferation and apoptosis of colorectal cancer (CRC) LS-147T and SW620 cells. CRC LS-147T and SW620 cells highly expressing PKM2 were randomly selected by quantitative
Yong Liu et al.
Oncotarget, 8(43), 75206-75216 (2017-11-02)
Platinum-based chemotherapeutic drugs are irreplaceable for the treatment of advanced non-small cell lung cancer (NSCLC). However, acquired drug resistance has become a major obstacle for the clinical application of chemotherapy on NSCLC. In the present study, we established carboplatin-resistant NSCLC
Zobrazit všechny související dokumenty

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.