Přejít k obsahu
Merck
Všechny fotografie(1)

Key Documents

EHU130851

Sigma-Aldrich

MISSION® esiRNA

targeting human EGF

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen
Všechny fotografie(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGCGAGAAAGGCTTATTGAGGAAGGAGTAGATGTGCCAGAAGGTCTTGCTGTGGACTGGATTGGCCGTAGATTCTATTGGACAGACAGAGGGAAATCTCTGATTGGAAGGAGTGATTTAAATGGGAAACGTTCCAAAATAATCACTAAGGAGAACATCTCTCAACCACGAGGAATTGCTGTTCATCCAATGGCCAAGAGATTATTCTGGACTGATACAGGGATTAATCCACGAATTGAAAGTTCTTCCCTCCAAGGCCTTGGCCGTCTGGTTATAGCCAGCTCTGATCTAATCTGGCCCAGTGGAATAACGATTGACTTCTTAACTGACAAGTTGTACTGGTGCGATGCCAAGCAGTCTGTGATTGAAATGGCCAATCTGGATGGTTCAAAACGCCGAAGACTTACCCAGAATGATGTAGGTCACCCATTTGCTGTAGCAGTGTTTGAGGATTATGTGTGGTTCTCAGATTGGGCTATGCCAT

Ensembl | human accession no.

ENSG00000138798

NCBI accession no.

NM_001963

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EGF(1950) , EGF(1950)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Mingli Duan et al.
Molecular medicine reports, 18(2), 1651-1659 (2018-05-31)
Migration and invasion are the most important characteristics of human malignancies which limit cancer drug therapies in the clinic. Tongue squamous cell carcinoma (TSCC) is one of the rarest types of cancer, although it is characterized by a higher incidence
Pengfei Liu et al.
Life sciences, 230, 45-54 (2019-05-28)
The action of cell-based therapy against acute kidney injury (AKI) has been demonstrated by different groups for years. However, which kind of cells hold best therapeutic effect remains unclear. In this study, we mainly explored whether human placental trophoblast cells
Ding Zhang et al.
Clinical and translational medicine, 10(8), e231-e231 (2020-12-31)
Acute lung injury is a serious form and major cause of patient death and still needs efficient therapies. The present study evidenced that co-transplantation of mesenchymal stem cells (MSCs) and telocytes (TCs) improved the severity of experimental lung tissue inflammation
Cuijie Li et al.
Journal of cellular physiology, 236(4), 2881-2892 (2020-11-25)
Intestinal mucosal injury is one of the most significant complications of burns. In our previous study, it was found that autophagy could alleviate burn-induced intestinal injury, but the underlying mechanisms are still unclear. Irregular expression of long noncoding RNAs (lncRNAs)
Dongqing Li et al.
The Journal of clinical investigation, 125(8), 3008-3026 (2015-06-30)
Wound healing is a complex process that is characterized by an initial inflammatory phase followed by a proliferative phase. This transition is a critical regulatory point; however, the factors that mediate this process are not fully understood. Here, we evaluated
Zobrazit všechny související dokumenty

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.