Přejít k obsahu
Merck
Všechny fotografie(1)

Hlavní dokumenty

EHU121861

Sigma-Aldrich

MISSION® esiRNA

targeting human TAF8

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCAAAACGGTCTCAGAGGATGGTCATCACTGCTCCTCCGGTGACCAATCAGCCAGTGACCCCCAAGGCCCTCACTGCAGGGCAGAACCGACCCCACCCGCCGCACATCCCCAGCCATTTTCCTGAGTTCCCTGATCCCCACACCTACATCAAAACTCCGACGTACCGTGAGCCCGTGTCAGACTACCAGGTCCTGCGGGAGAAGGCTGCATCCCAGAGGCGCGATGTGGAGCGGGCACTTACCCGTTTCATGGCCAAGACAGGCGAGACTCAGAGTCTTTTCAAAGATGACGTCAGCACATTTCCATTGATTGCTGCCAGACCTTTCACCATCCCCTACCTGACAGCTCTTCTTCCGTCTGAACTGGAGATGCAACAAATGGAACAGATTCCTCGGAGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Ještě jste nenalezli správný produkt?  

Vyzkoušejte náš produkt Nástroj pro výběr produktů.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Vyberte jednu z posledních verzí:

Osvědčení o analýze (COA)

Lot/Batch Number

Nevidíte správnou verzi?

Potřebujete-li konkrétní verzi, můžete vyhledat daný certifikát podle čísla dávky nebo čísla šarže.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

E Marques et al.
Oncogene, 35(11), 1386-1398 (2015-06-16)
Differentiated epithelial structure communicates with individual constituent epithelial cells to suppress their proliferation activity. However, the pathways linking epithelial structure to cessation of the cell proliferation machinery or to unscheduled proliferation in the context of tumorigenesis are not well defined.
Tetsuya Muto et al.
Investigative ophthalmology & visual science, 55(7), 4327-4337 (2014-06-19)
To investigate whether high glucose (HG) alters connexin 43 (Cx43) expression and gap junction intercellular communication (GJIC) activity in retinal Müller cells, and promotes Müller cell and pericyte loss. Retinal Müller cells (rMC-1) and cocultures of rMC-1 and retinal pericytes
Caitlin J Bowen et al.
Developmental biology, 407(1), 145-157 (2015-07-19)
Proper remodeling of the endocardial cushions into thin fibrous valves is essential for gestational progression and long-term function. This process involves dynamic interactions between resident cells and their local environment, much of which is not understood. In this study, we
Tomas Baldassarre et al.
Molecular cancer research : MCR, 13(6), 1044-1055 (2015-03-19)
Triple-negative breast cancers (TNBCs) are highly aggressive cancers that lack targeted therapies. However, EGFR is frequently activated in a subset of TNBCs and represents a viable clinical target. Because the endocytic adaptor protein Endophilin A2 (SH3GL1/Endo II) has been implicated
Zheren Shao et al.
PloS one, 10(7), e0132655-e0132655 (2015-07-24)
Melanomas cause over 76% of skin cancer deaths annually. Phosphatidylinositol 3-kinase (PI3K)-AKT-mammalian target of rapamycin (mTOR) signaling pathway is important for melanoma initiation and progression. In the current study, we evaluated the potential anti-melanoma effect of VS-5584, a novel and

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.