Přejít k obsahu
Merck
Všechny fotografie(1)

Key Documents

EHU086621

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR4

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen
Všechny fotografie(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACAAAGGTGGGAATGCTTTTTCAGAAGTTGATCTACCAAGCCTTGAGTTTCTAGATCTCAGTAGAAATGGCTTGAGTTTCAAAGGTTGCTGTTCTCAAAGTGATTTTGGGACAACCAGCCTAAAGTATTTAGATCTGAGCTTCAATGGTGTTATTACCATGAGTTCAAACTTCTTGGGCTTAGAACAACTAGAACATCTGGATTTCCAGCATTCCAATTTGAAACAAATGAGTGAGTTTTCAGTATTCCTATCACTCAGAAACCTCATTTACCTTGACATTTCTCATACTCACACCAGAGTTGCTTTCAATGGCATCTTCAATGGCTTGTCCAGTCTCGAAGTCTTGAAAATGGCTGGCAATTCTTTCCAGGAAAACTTCCTTCCAGATATCTTCACAGAGCTGAGAAACTTGACCTTCCTGGACCTCTC

Ensembl | human accession no.

ENSG00000136869

NCBI accession no.

NM_138554

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TLR4(7099) , TLR4(7099)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Rui Guo et al.
Scientific reports, 6, 32447-32447 (2016-09-02)
Acute liver disease is characterized by inflammation, oxidative stress and necrosis, which can greatly influence the long term clinical outcome and lead to liver failure or cancer. Here, we initially demonstrated the beneficial role of caspase-9-dependent autophagy in acute liver
Daniela Verzola et al.
Journal of cachexia, sarcopenia and muscle, 8(1), 131-144 (2016-11-30)
Inflammation in skeletal muscle is implicated in the pathogenesis of insulin resistance and cachexia but why uremia up-regulates pro-inflammatory cytokines is unknown. Toll-like receptors (TLRs) regulate locally the innate immune responses, but it is unknown whether in chronic kidney disease
Emmeline L Blanchard et al.
Molecular therapy. Nucleic acids, 14, 52-66 (2018-12-24)
The characterization of innate immune activation is crucial for vaccine and therapeutic development, including RNA-based vaccines, a promising approach. Current measurement methods quantify type I interferon and inflammatory cytokine production, but they do not allow for the isolation of individual pathways, do
Jing Chang et al.
PloS one, 12(9), e0184770-e0184770 (2017-09-13)
Interleukin 33 (IL-33), an inflammatory and mechanically responsive cytokine, is an important component of a TLR4-dependent innate immune process in mucosal epithelium. Although TLR4 also plays a role in sensing biomechanical stretch, a pathway of stretch-induced TLR4-dependent IL-33 biosynthesis has
Chao-Han Lai et al.
PloS one, 11(1), e0146565-e0146565 (2016-01-08)
Toll-like receptor (TLR) family plays a key role in innate immunity and various inflammatory responses. TLR4, one of the well-characterized pattern-recognition receptors, can be activated by endogenous damage-associated molecular pattern molecules such as high mobility group box 1 (HMGB1) to
Zobrazit všechny související dokumenty

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.