Přejít k obsahu
Merck
Všechny fotografie(1)

Key Documents

EHU076751

Sigma-Aldrich

MISSION® esiRNA

targeting human BRD4

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen
Všechny fotografie(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACCCTAACAAGCCCAAGAGGCAGACCAACCAACTGCAATACCTGCTCAGAGTGGTGCTCAAGACACTATGGAAACACCAGTTTGCATGGCCTTTCCAGCAGCCTGTGGATGCCGTCAAGCTGAACCTCCCTGATTACTATAAGATCATTAAAACGCCTATGGATATGGGAACAATAAAGAAGCGCTTGGAAAACAACTATTACTGGAATGCTCAGGAATGTATCCAGGACTTCAACACTATGTTTACAAATTGTTACATCTACAACAAGCCTGGAGATGACATAGTCTTAATGGCAGAAGCTCTGGAAAAGCTCTTCTTGCAAAAAATAAATGAGCTACCCACAGAAGAAACCGAGATCATGATAGTCCAGGCAAAAGGAAGAGGACGTGGGAGGAAAGAAACA

Ensembl | human accession no.

ENSG00000141867

NCBI accession no.

NM_058243

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BRD4(23476) , BRD4(23476)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Stella Liong et al.
Reproduction (Cambridge, England), 155(6), 573-582 (2018-05-12)
Preeclampsia affects 5% of all pregnancies and is a serious disorder of pregnancy, characterised by high maternal blood pressure, placental hypoxia, fluid retention (oedema) and proteinuria. Women with preeclampsia are associated with exaggerated levels of pro-inflammatory cytokines, chemokines and anti-angiogenic
Sushmita Mustafi et al.
EBioMedicine, 43, 201-210 (2019-04-13)
Bromodomain and extra-terminal inhibitors (BETi) have shown efficacy for the treatment of aggressive triple negative breast cancer (TNBC). However, BETi are plagued by a narrow therapeutic window as manifested by severe toxicities at effective doses. Therefore, it is a limitation
Zeynab Najafova et al.
Nucleic acids research, 45(1), 127-141 (2016-09-22)
Proper temporal epigenetic regulation of gene expression is essential for cell fate determination and tissue development. The Bromodomain-containing Protein-4 (BRD4) was previously shown to control the transcription of defined subsets of genes in various cell systems. In this study we
Xuanchen Zhou et al.
Frontiers in medicine, 7, 413-413 (2020-09-15)
Objectives: This study aimed to explore the relationship between bromodomain-containing protein 4 (BRD4), epithelial-mesenchymal transition (EMT), and disease severity in chronic rhinosinusitis with nasal polyps (CRSwNP). Methods: We performed immunofluorescent (IF) staining to evaluate the expression of BRD4 in the
Hong Zuo et al.
Biochimie, 165, 100-107 (2019-07-22)
High glucose (HG)-induced podocyte injury contributes to the pathogenesis of diabetic nephropathy, a severe complication of diabetes. Bromodomain-containing protein 4 (BRD4) has emerged as a critical regulator for cell injury. However, whether BRD4 participates in HG-induced podocyte injury remains unclear.
Zobrazit všechny související dokumenty

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.