Přejít k obsahu
Merck
Všechny fotografie(1)

Key Documents

EHU065141

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC39A14

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATGGACACAGCCATTATGCCTCTGAGTCGCTTCCCTCCAAGAAGGACCAGGAGGAGGGGGTGATGGAGAAGCTGCAGAACGGGGACCTGGACCACATGATTCCTCAGCACTGCAGCAGTGAGCTGGACGGCAAGGCGCCCATGGTGGACGAGAAGGTCATTGTGGGCTCGCTCTCTGTGCAGGACCTGCAGGCTTCCCAGAGTGCTTGCTACTGGCTGAAAGGTGTCCGCTACTCTGATATCGGCACTCTGGCCTGGATGATCACTCTGAGCGACGGCCTCCATAATTTCATCGATGGCCTGGCCATCGGTGCTTCCTTCACTGTGTCAGTTTTCCAAGGCATCAGCACCTCGGTGGCCATCCTCTGTGAGGAGTTCCCACATGAGCTAGGAGACTTTGTCATCCTGCTCAACG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Tolunay Beker Aydemir et al.
The Journal of biological chemistry, 291(46), 23939-23951 (2016-10-21)
Zinc influences signaling pathways through controlled targeted zinc transport. Zinc transporter Zip14 KO mice display a phenotype that includes impaired intestinal barrier function with low grade chronic inflammation, hyperinsulinemia, and increased body fat, which are signatures of diet-induced diabetes (type
Brittany L Steimle et al.
The Journal of biological chemistry, 294(50), 19197-19208 (2019-11-09)
Manganese supports numerous neuronal functions but in excess is neurotoxic. Consequently, regulation of manganese flux at the blood-brain barrier (BBB) is critical to brain homeostasis. However, the molecular pathways supporting the transcellular trafficking of divalent manganese ions within the microvascular
Yu Han et al.
Metallomics : integrated biometal science, 12(3), 346-362 (2020-01-18)
Zinc is the second most abundant transition metal in humans and an essential nutrient required for growth and development of newborns. During lactation, mammary epithelial cells differentiate into a secretory phenotype, uptake zinc from blood circulation, and export it into

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.