Přejít k obsahu
Merck
Všechny fotografie(1)

Key Documents

EHU028011

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC2A1

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen
Všechny fotografie(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCACTGTCGTGTCGCTGTTTGTGGTGGAGCGAGCAGGCCGGCGGACCCTGCACCTCATAGGCCTCGCTGGCATGGCGGGTTGTGCCATACTCATGACCATCGCGCTAGCACTGCTGGAGCAGCTACCCTGGATGTCCTATCTGAGCATCGTGGCCATCTTTGGCTTTGTGGCCTTCTTTGAAGTGGGTCCTGGCCCCATCCCATGGTTCATCGTGGCTGAACTCTTCAGCCAGGGTCCACGTCCAGCTGCCATTGCCGTTGCAGGCTTCTCCAACTGGACCTCAAATTTCATTGTGGGCATGTGCTTCCAGTATGTGGAGCAACTGTGTGGTCCCTACGTCTTCATCATCTTCACTGTGCTCCTGGTTCTGTTCTTCATCTTCACCTACTTCAAAGTTCCTGAGACTAAAGGCCGGACCTTCGATGAGATCGCTTCCGGCTTCCGGCAGGGGGGAGCCAGCCAAAGTGACAAGACACCCGAGG

Ensembl | human accession no.

ENSG00000117394

NCBI accession no.

NM_006516

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SLC2A1(6513) , SLC2A1(6513)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Huanyu Zhao et al.
Journal of Cancer, 10(20), 4989-4997 (2019-10-11)
Background: Glucose transporter 1 (GLUT1) is the main factor of Warburg effect, which is associated with poor prognosis in many tumors. However, the underlying molecular mechanism of GLUT1 in the progression of non-small cell lung cancer (NSCLC) is unclear. Methods:
Xiaohui Wei et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 54, 120-131 (2019-01-23)
Emerging hallmark of cancer is reprogrammed cellular metabolism, increased glycolytic metabolism is physiological characteristic of human malignant neoplasms. Saponin monomer 13 of the dwarf lilyturf tuber (DT-13) is the main steroidal saponin from Liriopes Radix, which has been reported to
Sarka Tumova et al.
Vascular pharmacology, 87, 219-229 (2016-11-09)
Endothelial cells are routinely exposed to elevated glucose concentrations post-prandially in healthy individuals and permanently in patients with metabolic syndrome and diabetes, and so we assessed their sugar transport capabilities in response to high glucose. In human umbilical vein (HUVEC)
Tian-Biao Zhang et al.
International journal of clinical and experimental medicine, 8(2), 2423-2428 (2015-05-02)
Glucose transporter-1 (GLUT-1) plays critical roles in cancer development and progression. Warburg effect (aerobic glycolysis) contributes greatly to tumorigenesis and could be targeted for tumor therapy. However, published data on the relationship between GLUT-1 and Warburg effect are scarce. In
Zhi-Peng You et al.
Scientific reports, 7(1), 7437-7437 (2017-08-09)
To investigate the effect of glucose transporter-1 (GLUT1) inhibition on diabetic retinopathy, we divided forty-eight mice into scrambled siRNA, diabetic scrambled siRNA, and GLUT1 siRNA (intravitreally injected) groups. Twenty-one weeks after diabetes induction, we calculated retinal glucose concentrations, used electroretinography
Zobrazit všechny související dokumenty

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.