Přejít k obsahu
Merck
Všechny fotografie(1)

Hlavní dokumenty

EHU023141

Sigma-Aldrich

MISSION® esiRNA

targeting human XPA

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCGAAGAATGTGGGAAAGAATTTATGGATTCTTATCTTATGAACCACTTTGATTTGCCAACTTGTGATAACTGCAGAGATGCTGATGATAAACACAAGCTTATAACCAAAACAGAGGCAAAACAAGAATATCTTCTGAAAGACTGTGATTTAGAAAAAAGAGAGCCACCTCTTAAATTTATTGTGAAGAAGAATCCACATCATTCACAATGGGGTGATATGAAACTCTACTTAAAGTTACAGATTGTGAAGAGGTCTCTTGAAGTTTGGGGTAGTCAAGAAGCATTAGAAGAAGCAAAGGAAGTCCGACAGGAAAACCGAGAAAAAATGAAACAGAAGAAATTTGATAAAAAAGTAAAAGAATTGCGGCGAGCAGTAAGAAGCAGCGTGTGGAAAAGGGAGACGATTGTTCATCAACATGAGTATGGACCAGAAGAAAACCTAGAAGATGACATGTACCGTAAGACTTGTACTATGTGTGGCCATGAACTGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Vyberte jednu z posledních verzí:

Osvědčení o analýze (COA)

Lot/Batch Number

Nevidíte správnou verzi?

Potřebujete-li konkrétní verzi, můžete vyhledat daný certifikát podle čísla dávky nebo čísla šarže.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Alaina R Martinez et al.
Genes, chromosomes & cancer, 56(8), 617-631 (2017-04-12)
Cancer cells require telomere maintenance to enable uncontrolled growth. Most often telomerase is activated, although a subset of human cancers are telomerase-negative and depend on recombination-based mechanisms known as ALT (Alternative Lengthening of Telomeres). ALT depends on proteins that are
Yi Wen Kong et al.
Nature communications, 11(1), 4124-4124 (2020-08-19)
In response to DNA damage, a synthetic lethal relationship exists between the cell cycle checkpoint kinase MK2 and the tumor suppressor p53. Here, we describe the concept of augmented synthetic lethality (ASL): depletion of a third gene product enhances a
Mariangela Sabatella et al.
Cellular and molecular life sciences : CMLS, 77(10), 2005-2016 (2019-08-09)
The effectiveness of many DNA-damaging chemotherapeutic drugs depends on their ability to form monoadducts, intrastrand crosslinks and/or interstrand crosslinks (ICLs) that interfere with transcription and replication. The ERCC1-XPF endonuclease plays a critical role in removal of these lesions by incising

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.