Přejít k obsahu
Merck
Všechny fotografie(1)

Key Documents

EHU022531

Sigma-Aldrich

MISSION® esiRNA

targeting human ULK1

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen
Všechny fotografie(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGAACCTCGCCAAGTCTCAGACGCTGCTGGGGAAGGAAATCAAAATCCTGAAGGAACTGAAACATGAAAACATCGTGGCCCTGTACGACTTCCAGGAAATGGCTAATTCTGTCTACCTGGTTATGGAGTACTGCAACGGTGGGGACCTGGCCGACTACCTGCACGCCATGCGCACGCTGAGCGAGGACACCATCAGGCTCTTCCTGCAGCAGATCGCGGGCGCCATGCGGCTTCTGCACAGCAAAGGCATCATCCACCGCGACCTGAAACCGCAGAACATCCTGCTGTCCAACCCCGCCGGCCGCCGCGCCAACCCCAACAGCATCCGCGTCAAGATCGCTGACTTCGGCTTCGCGCGGTACCTCCAGAGCAACATGATGGCGGCCACACTCTGCGGCTCCCCCATGTACATGGCCCCCGAGGTCATCATGTCCCAGCACTACGACGGGAAGGCGGACCTGTGGAGCATCGGCACCATCGTCTACCAGTGCCTGA

Ensembl | human accession no.

ENSG00000177169

NCBI accession no.

NM_003565

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ULK1(8408) , ULK1(8408)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Min Liu et al.
Toxicology letters, 283, 106-115 (2017-11-13)
Mitochondrial aldehyde dehydrogenase 2 (ALDH2), an important enzyme in the elimination of toxic aldehydes, is involved in cardioprotection against diabetes mellitus. This study was designed to examine the mechanism behind ALDH2-offered protection against high glucose exposure with a focus on
Katrin Spengler et al.
Cells, 9(3) (2020-03-15)
AMP-activated protein kinase (AMPK) is activated by vascular endothelial growth factor (VEGF) in endothelial cells and it is significantly involved in VEGF-induced angiogenesis. This study investigates whether the VEGF/AMPK pathway regulates autophagy in endothelial cells and whether this is linked
Qiang Xiao et al.
Theranostics, 10(22), 10245-10261 (2020-09-16)
Hepatocellular carcinoma (HCC) is the third most frequent cause of cancer-related deaths globally because of high metastasis and recurrence rates. Elucidating the molecular mechanisms of HCC recurrence and metastasis and developing effective targeted therapies are expected to improve patient survival.
Arup Sarkar et al.
The Journal of infectious diseases, 216(12), 1655-1666 (2017-10-14)
Macrophages are specialized phagocytic cells involved in clearing invading pathogens. Previously we reported that engulfment and cell motility protein 1 (ELMO1) in macrophages mediates bacterial internalization and intestinal inflammation. Here we studied the role of ELMO1 in the fate of
Yalitza Lopez Corcino et al.
Scientific reports, 9(1), 669-669 (2019-01-27)
Little is known about strategies used by pathogens to facilitate CNS invasion. Toxoplasma gondii reaches the CNS by circulating in blood within leukocytes or as extracellular tachyzoites. T. gondii induces EGFR signaling in vitro during invasion of mammalian cells. We
Zobrazit všechny související dokumenty

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.