Přejít k obsahu
Merck
Všechny fotografie(1)

Hlavní dokumenty

Zobrazit celou dokumentaci

EHU000311

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF1

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen
Všechny fotografie(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGTACCGGATGCTTCCACCTCTCACCAAGAACCAGAGAAAAGAAAGAAAGTCGAAGTCCAGCCGAGATGCTAAGAGCAAGGCCAAGAGGAAGTCATGTGGGGATTCCAGCCCTGATACCTTCTCTGATGGACTCAGCAGCTCCACTCTGCCTGATGACCACAGCAGCTACACAGTTCCAGGCTACATGCAGGACTTGGAGGTGGAGCAGGCCCTGACTCCAGCACTGTCGCCATGTGCTGTCAGCAGCACTCTCCCCGACTGGCACATCCCAGTGGAAGTTGTGCCGGACAGCACCAGTGATCTGTACAACTTCCAGGTGTCACCCATGCCCTCCACCTCTGAAGCTACAACAGATGAGGATGAGGAAGGGAAATTACCTGAGGACATCATGAAGCTCTTGGAGCAGTCGGAGTGGCAGCCAACAAACGTGGATGGGAAGGGGTACCTACTCAATGAACCTGGAGTCCAGCCCACCTCTGTCTATGGAGACTTTAGCTGTAAGGAGGAGCCAGAAATTGACAGCCCAGGGGGGGATATTGGGCTGAGTCTACAGCGTGTCTTCACAGATCTGAAGAACATGGATGCCACCT

Ensembl | human accession no.

ENSG00000125347

NCBI accession no.

NM_002198

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IRF1(3659) , IRF1(3659)

Související kategorie

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Jianhua Liu et al.
Arthritis & rheumatology (Hoboken, N.J.), 69(9), 1840-1849 (2017-06-01)
The inflammasome complex is a driver of organ damage in patients with systemic lupus erythematosus (SLE). Although type I interferons (IFNs) are well established as mediators of SLE pathogenesis, their role in inflammasome activation in SLE has not been assessed.
Z-D Liu et al.
European review for medical and pharmacological sciences, 24(23), 12334-12341 (2020-12-19)
Cerebral ischemia/reperfusion (CIR) frequently causes serious disabilities and correlates with certain neurological processes. Some studies have shown that microRNAs (miRNAs) exert a neuroprotective effect by modulating the inflammatory process in CIR. However, the biofunction and the mechanism of miR-130b in
Yihe Yan et al.
Cancer immunology, immunotherapy : CII, 69(9), 1891-1903 (2020-05-08)
The objective response rate of immune checkpoint blockade (ICB) in hepatocellular carcinoma (HCC) with anti PD-L1/PD-1 therapy is low. Discovering the signaling pathways regulating PD-L1 might help to improve ICB response rates. Here, we investigate transcription factors IRF-1 and IRF-2
Eri Sugiyama et al.
Science immunology, 5(43) (2020-02-02)
The clinical efficacy of anti-PD-1 (programmed cell death-1) monoclonal antibody (mAb) against cancers with oncogenic driver gene mutations, which often harbor a low tumor mutation burden, is variable, suggesting different contributions of each driver mutation to immune responses. Here, we
Lulu Tan et al.
American journal of cancer research, 10(4), 1255-1270 (2020-05-06)
Recent studies have shown that IRF-1 plays a significant role in various tumour-induced chemoresistance, but its role and mechanism in gastric cancer-associated chemoresistance are not clear. Our study showed that IRF-1 expression could reverse gastric cancer-related chemoresistance. Dysregulated DNA repair
Zobrazit všechny související dokumenty

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.