Saltar al contenido
Merck

EHU001691

Sigma-Aldrich

MISSION® esiRNA

targeting human PLK4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATTGCCAATTGAAACATCCTTCTATCTTGGAGCTTTATAACTATTTTGAAGATAGCAATTATGTGTATCTGGTATTAGAAATGTGCCATAATGGAGAAATGAACAGGTATCTAAAGAATAGAGTGAAACCCTTCTCAGAAAATGAAGCTCGACACTTCATGCACCAGATCATCACAGGGATGTTGTATCTTCATTCTCATGGTATACTACACCGGGACCTCACACTTTCTAACCTCCTACTGACTCGTAATATGAACATCAAGATTGCTGATTTTGGGCTGGCAACTCAACTGAAAATGCCACATGAAAAGCACTATACATTATGTGGAACTCCTAACTACATTTCACCAGAAATTGCCACTCGAAGTGCACATGGCCTTGAATCTGATGTTTGGTCCCTGGGCTGTATGTTTTATACATTACTTATCGGGAGACCACCCT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

C O Rosario et al.
Oncogene, 34(26), 3441-3451 (2014-09-02)
Polo family kinase 4 (Plk4) is required for mitotic progression, and is haploinsufficient for tumor suppression and timely hepatocyte polarization in regenerating liver. At the same time, recent evidence suggests that Plk4 expression may have a role in clinical cancer
Fernando R Balestra et al.
eLife, 10 (2021-01-26)
TRIM37 is an E3 ubiquitin ligase mutated in Mulibrey nanism, a disease with impaired organ growth and increased tumor formation. TRIM37 depletion from tissue culture cells results in supernumerary foci bearing the centriolar protein Centrin. Here, we characterize these centriolar

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico