Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU090641

Sigma-Aldrich

MISSION® esiRNA

targeting human RASAL2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGACTGGTCGCCAATTTGTAGAAAAGTGGTATCCAGTGAGTACACCTACACCCAACAAAGGAAAGACAGGAGGACCTTCTATTCGGATTAAATCACGTTTCCAAACTATCACCATTCTGCCTATGGAGCAATACAAAGAATTTGCAGAATTTGTCACCAGCAACTACACCATGCTGTGTTCTGTCCTTGAGCCAGTAATTAGTGTGAGAAATAAAGAGGAGTTGGCTTGTGCCTTAGTGCACATTCTTCAAAGTACTGGCAGAGCCAAGGATTTTCTGACTGACTTGGTGATGTCTGAGGTGGATCGTTGTGGAGAGCATGATGTCTTGATCTTCAGAGAGAACACTATTGCCACCAAATCCATTGAGGAATACCTCAAGTTGGTGGGACAACAGTATCTTCATGACGCACTGGGGGAGTTTATCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ke Hui et al.
Cell death & disease, 8(2), e2600-e2600 (2017-02-10)
Muscle-invasive or metastatic bladder cancer (BCa) is associated with a very poor prognosis, and the underlying mechanism remains poorly understood. In this study, we demonstrate RASAL2, a RAS GTPase-activating protein (RAS GAP), acts as a tumor suppressor in BCa. First
Libo Yin et al.
Molecular therapy oncolytics, 14, 74-81 (2019-05-03)
Pancreatic ductal adenocarcinoma (PDA) is one of the most lethal tumors, with poor therapeutic options in the advanced state. The broccoli-derived anti-inflammatory agent sulforaphane was shown to inhibit the progression of pancreatic cancer and other tumor entities. We examined the
Barbara Stefanska et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3118-3132 (2014-04-26)
We utilized whole-genome mapping of promoters that are activated by DNA hypomethylation in hepatocellular carcinoma (HCC) clinical samples to shortlist novel targets for anticancer therapeutics. We provide a proof of principle of this approach by testing six genes short-listed in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico