Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU002721

Sigma-Aldrich

MISSION® esiRNA

targeting human ERN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACAGTGACGCTTCCTGAAACCTTGTTGTTTGTGTCAACGCTGGATGGAAGTTTGCATGCTGTCAGCAAGAGGACAGGCTCAATCAAATGGACTTTAAAAGAAGATCCAGTCCTGCAGGTCCCAACACATGTGGAAGAGCCTGCCTTTCTCCCAGATCCTAATGATGGCAGCCTGTATACGCTTGGAAGCAAGAATAATGAAGGCCTGACGAAACTTCCTTTTACCATCCCAGAATTGGTGCAGGCATCCCCATGCCGAAGTTCAGATGGAATCCTCTACATGGGTAAAAAGCAGGACATCTGGTATGTTATTGACCTCCTGACCGGAGAGAAGCAGCAGACTTTGTCATCGGCCTTTGCAGATAGTCTCTGCCCATCAACCTCTCTTCTGTATCTTGGGCGAACAGAATACACCATCACCATGTACGACACCAAAACCCGAGAGCTCCGGTGGAATGCCACCTACTTTGACTATGCGGCCTCACTGCCTGAGGACGACGTGGACTACAAGATGTCCCACTTTGTGTCCAATGGTGATGGGCTGGTGGTGACTGTGGACAGT

Ensembl | human accession no.

ENSG00000178607

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ERN1(2081) , ERN1(2081)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Antonello Storniolo et al.
Oxidative medicine and cellular longevity, 2015, 645157-645157 (2015-04-30)
Relative to their normal counterparts, tumor cells generally exhibit a greater "stress phenotype" and express heat shock proteins (Hsp) that represent candidate targets for anticancer therapy. Here we investigated the role of Hsp70 in survival induced by endoplasmic reticulum (ER)
Anne-Sophie Michallet et al.
PloS one, 6(10), e25820-e25820 (2011-10-27)
To determine whether the Unfolded Protein Response (UPR) sensors (PERK, ATF6 and IRE-1) can be targeted to promote death of Multiple Myeloma (MM) cells. We have knocked-down separately each UPR stress sensor in human MM cell lines using RNA interference
Amanda Crider et al.
Molecular neurobiology, 55(9), 7606-7618 (2018-02-13)
Impaired social interaction is a key feature of several major psychiatric disorders including depression, autism, and schizophrenia. While, anatomically, the prefrontal cortex (PFC) is known as a key regulator of social behavior, little is known about the cellular mechanisms that
Qun Lai et al.
Yonsei medical journal, 54(6), 1407-1415 (2013-10-22)
To investigate the anti-apoptotic mechanism of leptin in non-small cell lung cancer. The influences of leptin on apoptosis were investigated, analyzing the mechanism that triggers growth of A549 cells. The effects of leptin on cell proliferation were examined by XTT
Xiaoli Hu et al.
Cancer cell international, 20, 250-250 (2020-06-23)
Acute myeloid leukemia (AML) patients with FMS-like tyrosine kinase 3-internal tandem duplication (FLT3-ITD) have a high relapse rate and poor prognosis. This study aims to explore the underlying mechanism of combining Gilteritinib with ATO at low concentration in the treatment
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico