HMI0001
MISSION® microRNA Mimic
hsa-let-7a
Sinonimo/i:
Mature Sequence: UGAGGUAGUAGGUUGUAUAGUU, hsa-let-7a-5p
Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
About This Item
Prodotti consigliati
Nome Commerciale
MISSION®
Stato
solid
N° accesso Sanger maturo/minor
N° accesso Sanger microRNA
Temperatura di conservazione
−20°C
Informazioni sul gene
Descrizione generale
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Altre note
miRBase V18 Mature ID update: hsa-let-7a-5p
Note legali
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Codice della classe di stoccaggio
11 - Combustible Solids
Classe di pericolosità dell'acqua (WGK)
WGK 3
Punto d’infiammabilità (°F)
Not applicable
Punto d’infiammabilità (°C)
Not applicable
Scegli una delle versioni più recenti:
Certificati d'analisi (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.
Se ti serve aiuto, non esitare a contattarci Servizio Clienti
Possiedi già questo prodotto?
I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.
Shubhangini Kataruka et al.
Nucleic acids research, 48(14), 8050-8062 (2020-07-02)
MicroRNAs (miRNAs) are ubiquitous small RNAs guiding post-transcriptional gene repression in countless biological processes. However, the miRNA pathway in mouse oocytes appears inactive and dispensable for development. We propose that marginalization of the miRNA pathway activity stems from the constraints
Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..
Contatta l'Assistenza Tecnica.