Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU116541

Sigma-Aldrich

MISSION® esiRNA

targeting human SGK3, C8ORF44-SGK3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00

Check Cart for Availability
Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

CHF 249.00

Check Cart for Availability

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTATTGCCGAGATGTTGCTGAAATGTATGACAATATCCTTCACAAACCCCTAAGTTTGAGGCCAGGAGTGAGTCTTACAGCCTGGTCCATTCTGGAAGAACTCCTAGAAAAAGACAGGCAAAATCGACTTGGTGCCAAGGAAGACTTTCTTGAAATTCAGAATCATCCTTTTTTTGAATCACTCAGCTGGGCTGACCTTGTACAAAAGAAGATTCCACCACCATTTAATCCTAATGTGGCTGGACCAGATGATATCAGAAACTTTGACACAGCATTTACAGAAGAAACAGTTCCATATTCTGTGTGTGTATCTTCTGACTATTCTATAGTGAATGCCAGTGTATTGGAGGCAGATGATGCATTCGTTGGTTTCTCTTATGCACCTCCTTCAGAAGACTTATTTTTGTGAGCAGTTTGCCATTC

N° accesso Ensembl | uomo

ENSG00000104205

N° accesso NCBI

NM_170709

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SGK3(100533105) , SGK3(23678)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
LYU
JUU
EES
RPR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yuanzhong Wang et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(8), E1500-E1508 (2017-02-09)
Many estrogen receptor alpha (ERα)-positive breast cancers initially respond to aromatase inhibitors (AIs), but eventually acquire resistance. Here, we report that serum- and glucocorticoid-inducible kinase 3 (SGK3), a kinase transcriptionally regulated by ERα in breast cancer, sustains ERα signaling and
Laura Creevey et al.
Molecular cancer therapeutics, 18(10), 1731-1743 (2019-07-11)
Divergent roles for androgen receptor (AR) in breast cancer have been reported. Following aromatase inhibitor (AI) treatment, the conversion of circulating androgens into estrogens can be diminished by >99%. We wished to establish whether the steroid environment can dictate the
Shingo Miyata et al.
Biochemical and biophysical research communications, 464(1), 76-82 (2015-06-06)
Major depression, one of the most prevalent mental illnesses, is thought to be a multifactorial disease related to both genetic and environmental factors. However, the genes responsible for and the pathogenesis of major depression at the molecular level remain unclear.
Huailei Liu et al.
Journal of neuro-oncology, 122(3), 431-439 (2015-02-28)
Glioblastoma multiforme (GBM) is the most malignant brain tumor in humans. Previous studies have demonstrated that microRNA plays important roles in the development and proliferation of GBM cells. Here we defined the mechanism by which miR-212-3p regulated the proliferation of

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.