Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU063661

Sigma-Aldrich

MISSION® esiRNA

targeting human METTL3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00

Check Cart for Availability
Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

CHF 249.00

Check Cart for Availability

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAGCCAGCCAAGAAATCAAGGAAACATGCTGCCTCAGATGTTGATCTGGAGATAGAGAGCCTTCTGAACCAACAGTCCACTAAGGAACAACAGAGCAAGAAGGTCAGTCAGGAGATCCTAGAGCTATTAAATACTACAACAGCCAAGGAACAATCCATTGTTGAAAAATTTCGCTCTCGAGGTCGGGCCCAAGTGCAAGAATTCTGTGACTATGGAACCAAGGAGGAGTGCATGAAAGCCAGTGATGCTGATCGACCCTGTCGCAAGCTGCACTTCAGACGAATTATCAATAAACACACTGATGAGTCTTTAGGTGACTGCTCTTTCCTTAATACATGTTTCCACATGGATACCTGCAAGTATGTTCACTATGAAATTGATGCTTGCATGGATTCTGAGGCCCCTGGCAGCAAAGACCACACGCCAAGCCAGGAGCTTGCTCTTACACAGAGTGTCGGAGGTGATTCCAGT

N° accesso Ensembl | uomo

ENSG00000165819

N° accesso NCBI

NM_019852

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... METTL3(56339) , METTL3(56339)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Classe di pericolosità dell'acqua (WGK)

WGK 1

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
YDV
EAU

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ye Lin et al.
Cancer medicine, 9(8), 2859-2867 (2020-02-19)
METTL3 is an RNA methyltransferase implicated in the control of cell differentiation and proliferation in embryonic development and cancer. The current study was aimed to explore the function and underlying mechanism of METTL3 in hepatocellular carcinoma (HCC). We evaluated the
Shiyan Gu et al.
Toxicology letters, 292, 1-11 (2018-04-24)
N6-methyladenosine (m6A) modification is implicated to play an important role in cellular biological processes, but its regulatory mechanisms in arsenite-induced carcinogenesis are largely unknown. Here, human bronchial epithelial (HBE) cells were chronically treated with 2.5 μM arsenite sodium (NaAsO2) for about
Hongbing Wu et al.
Genes and immunity, 21(3), 193-202 (2020-05-28)
Maturation of dendritic cells (DCs) initiates adaptive immune responses and thereby provokes allograft rejection. Here, this study aimed to explore the effect of Methyltransferase-like protein 3 (METTL3) silencing on DC function and the role of METTL3-silencing donor DCs in the
Daniel A Lorenz et al.
RNA (New York, N.Y.), 26(1), 19-28 (2019-10-19)
Direct RNA sequencing holds great promise for the de novo identification of RNA modifications at single-coordinate resolution; however, interpretation of raw sequencing output to discover modified bases remains a challenge. Using Oxford Nanopore's direct RNA sequencing technology, we developed a
Ly P Vu et al.
Nature medicine, 23(11), 1369-1376 (2017-09-19)
N6-methyladenosine (m6A) is an abundant nucleotide modification in mRNA that is required for the differentiation of mouse embryonic stem cells. However, it remains unknown whether the m6A modification controls the differentiation of normal and/or malignant myeloid hematopoietic cells. Here we
Visualizza tutti i documenti correlati

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.