Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU040501

Sigma-Aldrich

MISSION® esiRNA

targeting human UHRF1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGTGGACCATGGGAATTTTTTCACATACACGGGTAGTGGTGGTCGAGATCTTTCCGGCAACAAGAGGACCGCGGAACAGTCTTGTGATCAGAAACTCACCAACACCAACAGGGCGCTGGCTCTCAACTGCTTTGCTCCCATCAATGACCAAGAAGGGGCCGAGGCCAAGGACTGGCGGTCGGGGAAGCCGGTCAGGGTGGTGCGCAATGTCAAGGGTGGCAAGAATAGCAAGTACGCCCCCGCTGAGGGCAACCGCTACGATGGCATCTACAAGGTTGTGAAATACTGGCCCGAGAAGGGGAAGTCCGGGTTTCTCGTGTGGCGCTACCTTCTGCGGAGGGACGATGATGAGCCTGGCCCTTGGACGAAGGAGGGGAAGGACCGGATCAAGAAGCTGGGGCTGACCATGCAGTATCCAGAAGGCTACCTGGAAGCCCTGGCCAACCGAGAGCGAGAGAAGGAGAA

N° accesso Ensembl | uomo

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ting-Ting Ge et al.
Journal of ovarian research, 9(1), 42-42 (2016-07-20)
Up-regulation of UHRF1 has been observed in a variety of cancers and appears to serve as an independent prognostic factor. To explore the effect of UHRF1 gene silencing on apoptosis and proliferation of cervical squamous cell carcinoma (CSCC) CaSki cells.
Daiki Goto et al.
Cancer investigation, 38(4), 240-249 (2020-03-28)
We evaluated the value of UHRF1, a regulator of methylation, as a biomarker for lung cancer. UHRF1 is expressed at higher levels in both lung adenocarcinoma (AD) and squamous cell carcinoma (SQ); however, a meta-analysis showed that UHRF1 expression is
Mahmoud Alhosin et al.
Technology in cancer research & treatment, 19, 1533033820947489-1533033820947489 (2020-09-12)
Thymoquinone (TQ), a natural anticancer agent exerts cytotoxic effects on several tumors by targeting multiple pathways, including apoptosis. Difluoromethylornithine (DFMO), an irreversible inhibitor of the ornithine decarboxylase (ODC) enzyme, has shown promising inhibitory activities in many cancers including leukemia by
Jieying Chen et al.
Journal of cellular and molecular medicine, 22(5), 2856-2864 (2018-03-09)
WD repeat protein 79 (WDR79) is a member of the WD-repeat protein family characterized by the presence of a series of WD-repeat domains and is a scaffold protein that participates in telomerase assembly, Cajal body formation and DNA double strand
Guangyan Kan et al.
Oncotarget, 8(24), 39497-39511 (2017-05-04)
UHRF1 (ubiquitin-like with PHD and RING finger domains 1) is a critical regulator for DNA methylation, and its frequent overexpression in human cancers has been associated with tumor-promoting effects. However, whether the overexpressed UHRF1 contributes to the establishment and maintenance

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.