Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU073481

Sigma-Aldrich

MISSION® esiRNA

targeting human EZH2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Check Cart for Availability


Scegli un formato

Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

CHF 249.00


Check Cart for Availability

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCATGCAACACCCAACACTTATAAGCGGAAGAACACAGAAACAGCTCTAGACAACAAACCTTGTGGACCACAGTGTTACCAGCATTTGGAGGGAGCAAAGGAGTTTGCTGCTGCTCTCACCGCTGAGCGGATAAAGACCCCACCAAAACGTCCAGGAGGCCGCAGAAGAGGACGGCTTCCCAATAACAGTAGCAGGCCCAGCACCCCCACCATTAATGTGCTGGAATCAAAGGATACAGACAGTGATAGGGAAGCAGGGACTGAAACGGGGGGAGAGAACAATGATAAAGAAGAAGAAGAGAAGAAAGATGAAACTTCGAGCTCCTCTGAAGCAAATTCTCGGTGTCAAACACCAATAAAGATGAAGCCAAATATTGAACCTCCTGAGAATGTGGAGTGGAGTGGTGCT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hailong Liu et al.
Molecular cancer research : MCR, 15(9), 1275-1286 (2017-05-26)
Medulloblastoma is the most common malignant brain tumor in children. Although accumulated research has suggested that cancer stem-like cells play a key role in medulloblastoma tumorigenesis, the specific molecular mechanism regarding proliferation remains elusive. Here, we reported more abundant expression
Junchao Xue et al.
Biochimica et biophysica acta, 1863(3), 753-763 (2017-01-08)
Circular RNAs (circRNAs), a class of noncoding RNAs generated from pre-mRNAs, participate in regulation of genes. The mechanism for regulation, however, is unknown. Here, to determine if, in human keratinocyte (HaCaT) cells, circular RNAs are involved in arsenite-induced acceleration of
Jiewei Xu et al.
Pathology, research and practice, 215(6), 152374-152374 (2019-04-07)
EZH2 is a core component of the polycomb repressive complex 2 (PRC2), which catalyzes trimethylation of histone H3 lysine 27 (H3K27me3) and promotes carcinogenesis by epigenetically silencing many tumor suppressor genes. Increased EZH2 expression is a marker of advanced and
Wei Dong et al.
American journal of physiology. Cell physiology, 317(2), C253-C261 (2019-01-17)
Myocardial ischemia-reperfusion (I/R) is a common and lethal disease that threatens people's life worldwide. The underlying mechanisms are under intensive study and yet remain unclear. Here, we explored the function of miR-322/503 in myocardial I/R injury. We used isolated rat
Han-Li Huang et al.
Theranostics, 9(22), 6676-6689 (2019-10-08)
Tissue inhibitors of metalloproteinase 3 (TIMP3) are a major endogenous inhibitor of matrix metalloproteinase (MMPs) that inhibit tumor growth, invasion, metastasis and angiogenesis. In this study, we found that TIMP3 expression is associated with positive prognosis of colorectal cancer (CRC)

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.