Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU016631

Sigma-Aldrich

MISSION® esiRNA

targeting human TXNIP

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Check Cart for Availability


Scegli un formato

Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

CHF 249.00


Check Cart for Availability

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCCACACTTACCTTGCCAATGGCCAGACCAAGGTGCTGACTCAGAAGTTGTCATCAGTCAGAGGCAATCATATTATCTCAGGGACATGCGCATCATGGCGTGGCAAGAGCCTTCGGGTTCAGAAGATCAGGCCTTCTATCCTGGGCTGCAACATCCTTCGAGTTGAATATTCCTTACTGATCTATGTTAGCGTTCCTGGATCCAAGAAGGTCATCCTTGACCTGCCCCTGGTAATTGGCAGCAGATCAGGTCTAAGCAGCAGAACATCCAGCATGGCCAGCCGAACCAGCTCTGAGATGAGTTGGGTAGATCTGAACATCCCTGATACCCCAGAAGCTCCTCCCTGCTATATGGATGTCATTCCTGAAGATCACCGATTGGAGAGCCCAACCACTCCTCTGCTAGATGACATGGATGGCTCTCAAG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Chad N Brocker et al.
Nature communications, 11(1), 5847-5847 (2020-11-19)
Exploring the molecular mechanisms that prevent inflammation during caloric restriction may yield promising therapeutic targets. During fasting, activation of the nuclear receptor peroxisome proliferator-activated receptor α (PPARα) promotes the utilization of lipids as an energy source. Herein, we show that
Si-Qi Du et al.
CNS neuroscience & therapeutics, 24(1), 39-46 (2017-11-08)
Oxidative stress and inflammation have been implicated in the pathogenesis of vascular dementia (VD). Thioredoxin-interacting protein (TXNIP) plays a vital role in oxidative stress and NOD-like receptor protein 3 (NLRP3) inflammasome activation. There is evidence that acupuncture has an antioxidative
Yu Tian et al.
Neurochemical research, 45(2), 428-436 (2019-12-21)
Ischemic stroke is a life-threatening cerebrovascular thrombotic disease, oxidative stress is considered to be a critical factor to stroke pathophysiology. This study aimed to investigate the underlying molecular mechanism and propose the potential therapeutic strategy for ischemic stroke. Bioinformatics analysis
Jianjun Jiang et al.
Lipids in health and disease, 20(1), 19-19 (2021-02-23)
This study aimed to explore the effects of ceramide (Cer) on NLRP3 inflammasome activation and their underlying mechanisms. Lipopolysaccharide (LPS)/adenosine triphosphate (ATP)-induced NLRP3 inflammasome activation in J774A.1 cells and THP-1 macrophages was used as an in vitro model of inflammation.
Tina Oberacker et al.
FEBS letters, 592(13), 2297-2307 (2018-06-14)
The "free radical theory of aging" suggests that reactive oxygen species (ROS) are responsible for age-related loss of cellular functions and, therefore, represent the main cause of aging. Redox regulation by thioredoxin-1 (TRX) plays a crucial role in responses to

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.